EMAIL THIS PAGE TO A FRIEND

USO1

USO1 vesicle transport factor

Synonyms: P115 TAP VDP
UniProtKB ID: O60763, B2RAQ0, Q6PK63, Q86TB8, Q8N592
Gene ID:
Human(8615) Summary: The protein encoded by this gene is a peripheral membrane protein which recycles between the cytosol and the Golgi apparatus during interphase. It is regulated by phosphorylation: dephosphorylated protein associates with the Golgi membrane and dissociates from the membrane upon phosphorylation. Ras-associated protein 1 recruits this protein to coat protein complex II (COPII) vesicles during budding from the endoplasmic reticulum, where it interacts with a set of COPII vesicle-associated SNAREs to form a cis-SNARE complex that promotes targeting to the Golgi apparatus. Transport from the ER to the cis/medial Golgi compartments requires the action of this gene product, GM130 and giantin in a sequential manner. [provided by RefSeq, Jul 2008]
Mouse(56041) USO1 vesicle docking factor
Rat(56042) USO1 vesicle transport factor
Zebrafish(393124) USO1 homolog, vesicle docking protein (yeast)
dog(478430) USO1 vesicle docking protein homolog (yeast)
chicken(422575) USO1 vesicle docking protein homolog (yeast)
domestic cat(101100888) USO1 vesicle docking protein homolog (yeast)
Horse(100050841) USO1 vesicle docking protein homolog (yeast)
naked mole-rat(101697136) USO1 vesicle transport factor
Domestic Rabbit(100341631) USO1 vesicle docking protein homolog (yeast)
domestic guinea pig(100713558) USO1 vesicle transport factor
cow(317724) USO1 vesicle docking protein homolog (yeast)
sheep(101107444) USO1 vesicle docking protein homolog (yeast)
153 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003715 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019490 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019490 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019490 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003715 Rosetta Predictions human pricing
NM_019379 Rosetta Predictions rat pricing
NM_019490 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073803 predicted 1658
2 SASI_Hs01_00073804 predicted 1401
3 SASI_Hs02_00336140 predicted 1425
4 SASI_Hs01_00073806 predicted 2171
5 SASI_Hs01_00073808 predicted 2313
6 SASI_Hs01_00073810 predicted 2300
7 SASI_Hs02_00336141 predicted 3076
8 SASI_Hs02_00336142 predicted 2949
9 SASI_Hs01_00073811 predicted 2259
10 SASI_Hs01_00073812 predicted 3113
11 SASI_Hs01_00073805 predicted 2787
12 SASI_Hs01_00073807 predicted 2109
13 SASI_Hs01_00073809 predicted 1994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039825 predicted 613
2 SASI_Rn01_00039826 predicted 412
3 SASI_Rn01_00039827 predicted 1582
4 SASI_Rn01_00039828 predicted 1297
5 SASI_Rn02_00262413 predicted 1821
6 SASI_Rn02_00262414 predicted 2992
7 SASI_Rn01_00039830 predicted 284
8 SASI_Rn01_00039832 predicted 2231
9 SASI_Rn01_00039833 predicted 1327
10 SASI_Rn01_00039834 predicted 213
11 SASI_Rn01_00039829 predicted 2808
12 SASI_Rn01_00039831 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027863 predicted 700
2 SASI_Mm01_00027864 predicted 390
3 SASI_Mm02_00324512 predicted 2684
4 SASI_Mm01_00027866 predicted 1360
5 SASI_Mm01_00027867 predicted 472
6 SASI_Mm01_00027868 predicted 1670
7 SASI_Mm01_00027870 predicted 1918
8 SASI_Mm01_00027871 predicted 1651
9 SASI_Mm01_00027872 predicted 1153
10 SASI_Mm02_00324513 predicted 1383
11 SASI_Mm01_00027865 predicted 1978
12 SASI_Mm01_00027869 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003715
VALIDATED
USO1 MISSION shRNA Bacterial Glycerol Stock
USO1 vesicle transport factor
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003715.2-1094s21c1
Sequence:CCGGATGTTCCAGTGTGGGTTATTGCTCGAGCAATAACCCACACTGGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003715.2-302s21c1
Sequence:CCGGGTTCGTGCTCTCAAATCATTACTCGAGTAATGATTTGAGAGCACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003715.2-3467s21c1
Sequence:CCGGTGAGTCCTTAGTTGATGATTTCTCGAGAAATCATCAACTAAGGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003715.2-3361s21c1
Sequence:CCGGCCTTAGTTCATTCGTTGTTTACTCGAGTAAACAACGAATGAACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003715.2-1806s21c1
Sequence:CCGGTGTTGGGCATTTCGATTTATTCTCGAGAATAAATCGAAATGCCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003715.2-3078s21c1
Sequence:CCGGAGGAACAATAGAGATTATATCCTCGAGGATATAATCTCTATTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003715.1-1441s1c1
Sequence:CCGGCCAGTTATTATGTGGAGGTTTCTCGAGAAACCTCCACATAATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003715.1-2729s1c1
Sequence:CCGGGCATTATTACAAGAGACCAAACTCGAGTTTGGTCTCTTGTAATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003715.1-1117s1c1
Sequence:CCGGGCAGCTTTGTACTATCCTAATCTCGAGATTAGGATAGTACAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_003715.1-1848s1c1
Sequence:CCGGGCTACATGAAAGAGAAGCTAACTCGAGTTAGCTTCTCTTTCATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003715.1-995s1c1
Sequence:CCGGGCACAGAAAGTGACCAATCTACTCGAGTAGATTGGTCACTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003715.2-1407s21c1
Sequence:CCGGCCATTGATGCAACAGGTAATTCTCGAGAATTACCTGTTGCATCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003715
VALIDATED
USO1 MISSION shRNA shRNA Plasmid DNA
USO1 vesicle transport factor
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003715.2-1094s21c1
Sequence:CCGGATGTTCCAGTGTGGGTTATTGCTCGAGCAATAACCCACACTGGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003715.2-302s21c1
Sequence:CCGGGTTCGTGCTCTCAAATCATTACTCGAGTAATGATTTGAGAGCACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003715.2-3467s21c1
Sequence:CCGGTGAGTCCTTAGTTGATGATTTCTCGAGAAATCATCAACTAAGGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003715.2-3361s21c1
Sequence:CCGGCCTTAGTTCATTCGTTGTTTACTCGAGTAAACAACGAATGAACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003715.2-1806s21c1
Sequence:CCGGTGTTGGGCATTTCGATTTATTCTCGAGAATAAATCGAAATGCCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003715.2-3078s21c1
Sequence:CCGGAGGAACAATAGAGATTATATCCTCGAGGATATAATCTCTATTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003715.1-1441s1c1
Sequence:CCGGCCAGTTATTATGTGGAGGTTTCTCGAGAAACCTCCACATAATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003715.1-2729s1c1
Sequence:CCGGGCATTATTACAAGAGACCAAACTCGAGTTTGGTCTCTTGTAATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003715.1-1117s1c1
Sequence:CCGGGCAGCTTTGTACTATCCTAATCTCGAGATTAGGATAGTACAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_003715.1-1848s1c1
Sequence:CCGGGCTACATGAAAGAGAAGCTAACTCGAGTTAGCTTCTCTTTCATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003715.1-995s1c1
Sequence:CCGGGCACAGAAAGTGACCAATCTACTCGAGTAGATTGGTCACTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003715.2-1407s21c1
Sequence:CCGGCCATTGATGCAACAGGTAATTCTCGAGAATTACCTGTTGCATCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003715
VALIDATED
USO1 MISSION shRNA Lentiviral Transduction Particles
USO1 vesicle transport factor
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003715.2-1094s21c1
Sequence:CCGGATGTTCCAGTGTGGGTTATTGCTCGAGCAATAACCCACACTGGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003715.2-302s21c1
Sequence:CCGGGTTCGTGCTCTCAAATCATTACTCGAGTAATGATTTGAGAGCACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003715.2-3467s21c1
Sequence:CCGGTGAGTCCTTAGTTGATGATTTCTCGAGAAATCATCAACTAAGGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003715.2-3361s21c1
Sequence:CCGGCCTTAGTTCATTCGTTGTTTACTCGAGTAAACAACGAATGAACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003715.2-1806s21c1
Sequence:CCGGTGTTGGGCATTTCGATTTATTCTCGAGAATAAATCGAAATGCCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003715.2-3078s21c1
Sequence:CCGGAGGAACAATAGAGATTATATCCTCGAGGATATAATCTCTATTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003715.1-1441s1c1
Sequence:CCGGCCAGTTATTATGTGGAGGTTTCTCGAGAAACCTCCACATAATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003715.1-2729s1c1
Sequence:CCGGGCATTATTACAAGAGACCAAACTCGAGTTTGGTCTCTTGTAATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003715.1-1117s1c1
Sequence:CCGGGCAGCTTTGTACTATCCTAATCTCGAGATTAGGATAGTACAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_003715.1-1848s1c1
Sequence:CCGGGCTACATGAAAGAGAAGCTAACTCGAGTTAGCTTCTCTTTCATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003715.1-995s1c1
Sequence:CCGGGCACAGAAAGTGACCAATCTACTCGAGTAGATTGGTCACTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003715.2-1407s21c1
Sequence:CCGGCCATTGATGCAACAGGTAATTCTCGAGAATTACCTGTTGCATCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019490
VALIDATED
USO1 MISSION shRNA Bacterial Glycerol Stock
USO1 vesicle transport factor
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-1145s21c1
Sequence:CCGGATCCTGACAGAGACCATAAATCTCGAGATTTATGGTCTCTGTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019490.1-3056s21c1
Sequence:CCGGATGATAGAGATTACGTCATTACTCGAGTAATGACGTAATCTCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-2512s21c1
Sequence:CCGGCGAGCAAGTTGCAGAGTTAAACTCGAGTTTAACTCTGCAACTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-2113s21c1
Sequence:CCGGCGTGACTCACTATAAGAATATCTCGAGATATTCTTATAGTGAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-2026s21c1
Sequence:CCGGTGTTATTACCAAGGCTATTTACTCGAGTAAATAGCCTTGGTAATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019490.1-3422s21c1
Sequence:GTACCGGTTGAGTTCTCGGCTGATTAATCTCGAGATTAATCAGCCGAGAACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-721s21c1
Sequence:GTACCGGCTTACTACTGCAGGCATTAACCTCGAGGTTAATGCCTGCAGTAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019490.1-3698s1c1
Sequence:CCGGGCAGTTCATATAGCTGGGATTCTCGAGAATCCCAGCTATATGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019490.1-2512s1c1
Sequence:CCGGCGAGCAAGTTGCAGAGTTAAACTCGAGTTTAACTCTGCAACTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019490.1-2113s1c1
Sequence:CCGGCGTGACTCACTATAAGAATATCTCGAGATATTCTTATAGTGAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019490.1-320s1c1
Sequence:CCGGCGCTTAGAAGTGGGAATCCAACTCGAGTTGGATTCCCACTTCTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019490.1-2511s1c1
Sequence:CCGGCCGAGCAAGTTGCAGAGTTAACTCGAGTTAACTCTGCAACTTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019490
VALIDATED
USO1 MISSION shRNA shRNA Plasmid DNA
USO1 vesicle transport factor
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-1145s21c1
Sequence:CCGGATCCTGACAGAGACCATAAATCTCGAGATTTATGGTCTCTGTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019490.1-3056s21c1
Sequence:CCGGATGATAGAGATTACGTCATTACTCGAGTAATGACGTAATCTCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-2512s21c1
Sequence:CCGGCGAGCAAGTTGCAGAGTTAAACTCGAGTTTAACTCTGCAACTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-2113s21c1
Sequence:CCGGCGTGACTCACTATAAGAATATCTCGAGATATTCTTATAGTGAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-2026s21c1
Sequence:CCGGTGTTATTACCAAGGCTATTTACTCGAGTAAATAGCCTTGGTAATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019490.1-3422s21c1
Sequence:GTACCGGTTGAGTTCTCGGCTGATTAATCTCGAGATTAATCAGCCGAGAACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-721s21c1
Sequence:GTACCGGCTTACTACTGCAGGCATTAACCTCGAGGTTAATGCCTGCAGTAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019490.1-3698s1c1
Sequence:CCGGGCAGTTCATATAGCTGGGATTCTCGAGAATCCCAGCTATATGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019490.1-2512s1c1
Sequence:CCGGCGAGCAAGTTGCAGAGTTAAACTCGAGTTTAACTCTGCAACTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019490.1-2113s1c1
Sequence:CCGGCGTGACTCACTATAAGAATATCTCGAGATATTCTTATAGTGAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019490.1-320s1c1
Sequence:CCGGCGCTTAGAAGTGGGAATCCAACTCGAGTTGGATTCCCACTTCTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019490.1-2511s1c1
Sequence:CCGGCCGAGCAAGTTGCAGAGTTAACTCGAGTTAACTCTGCAACTTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019490
VALIDATED
USO1 MISSION shRNA Lentiviral Transduction Particles
USO1 vesicle transport factor
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-1145s21c1
Sequence:CCGGATCCTGACAGAGACCATAAATCTCGAGATTTATGGTCTCTGTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019490.1-3056s21c1
Sequence:CCGGATGATAGAGATTACGTCATTACTCGAGTAATGACGTAATCTCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-2512s21c1
Sequence:CCGGCGAGCAAGTTGCAGAGTTAAACTCGAGTTTAACTCTGCAACTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-2113s21c1
Sequence:CCGGCGTGACTCACTATAAGAATATCTCGAGATATTCTTATAGTGAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-2026s21c1
Sequence:CCGGTGTTATTACCAAGGCTATTTACTCGAGTAAATAGCCTTGGTAATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019490.1-3422s21c1
Sequence:GTACCGGTTGAGTTCTCGGCTGATTAATCTCGAGATTAATCAGCCGAGAACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019490.1-721s21c1
Sequence:GTACCGGCTTACTACTGCAGGCATTAACCTCGAGGTTAATGCCTGCAGTAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019490.1-3698s1c1
Sequence:CCGGGCAGTTCATATAGCTGGGATTCTCGAGAATCCCAGCTATATGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019490.1-2512s1c1
Sequence:CCGGCGAGCAAGTTGCAGAGTTAAACTCGAGTTTAACTCTGCAACTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019490.1-2113s1c1
Sequence:CCGGCGTGACTCACTATAAGAATATCTCGAGATATTCTTATAGTGAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019490.1-320s1c1
Sequence:CCGGCGCTTAGAAGTGGGAATCCAACTCGAGTTGGATTCCCACTTCTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019490.1-2511s1c1
Sequence:CCGGCCGAGCAAGTTGCAGAGTTAACTCGAGTTAACTCTGCAACTTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks