EMAIL THIS PAGE TO A FRIEND

USP10

ubiquitin specific peptidase 10

Synonyms: UBPO
UniProtKB ID: Q14694, B2RDJ8, B4DS84, Q9BWG7, Q9NSL7
Gene ID:
Human(9100) Summary: Ubiquitin is a highly conserved protein that is covalently linked to other proteins to regulate their function and degradation. This gene encodes a member of the ubiquitin-specific protease family of cysteine proteases. The enzyme specifically cleaves ubiquitin from ubiquitin-conjugated protein substrates. The protein is found in the nucleus and cytoplasm. It functions as a co-factor of the DNA-bound androgen receptor complex, and is inhibited by a protein in the Ras-GTPase pathway. The human genome contains several pseudogenes similar to this gene. Several transcript variants, some protein-coding and others not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2013]
Mouse(22224) ubiquitin specific peptidase 10
Rat(307905) ubiquitin specific peptidase 10
Zebrafish(564632) ubiquitin specific peptidase 10
dog(479625) ubiquitin specific peptidase 10
Horse(100070208) ubiquitin specific peptidase 10
domestic cat(101089411) ubiquitin specific peptidase 10
chicken(415817) ubiquitin specific peptidase 10
naked mole-rat(101697320) ubiquitin specific peptidase 10
Domestic Rabbit(100339364) ubiquitin specific peptidase 10
domestic guinea pig(100716490) ubiquitin specific peptidase 10
cow(510164) ubiquitin specific peptidase 10
sheep(101102257) ubiquitin specific peptidase 10
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005153 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106711 MISSION® esiRNA esiRNA human USP10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005153 Rosetta Predictions human pricing
NM_001034146 Rosetta Predictions rat pricing
NM_009462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213007 predicted 325
2 SASI_Hs01_00213008 predicted 512
3 SASI_Hs01_00213009 predicted 1663
4 SASI_Hs01_00213010 predicted 2378
5 SASI_Hs01_00213011 predicted 989
6 SASI_Hs01_00213012 predicted 679
7 SASI_Hs01_00213014 predicted 401
8 SASI_Hs01_00213015 predicted 1210
9 SASI_Hs01_00213016 predicted 652
10 SASI_Hs02_00339088 predicted 804
11 SASI_Hs01_00213013 predicted 2103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083261 predicted 2344
2 SASI_Rn01_00083262 predicted 548
3 SASI_Rn02_00204000 predicted 1894
4 SASI_Rn01_00083263 predicted 1474
5 SASI_Rn01_00083264 predicted 1564
6 SASI_Rn01_00083265 predicted 2262
7 SASI_Rn01_00083266 predicted 240
8 SASI_Rn01_00083267 predicted 1851
9 SASI_Rn01_00083269 predicted 211
10 SASI_Rn01_00083270 predicted 2496
11 SASI_Rn01_00083268 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180477 predicted 1380
2 SASI_Mm01_00180478 predicted 535
3 SASI_Mm01_00180479 predicted 2336
4 SASI_Mm01_00180480 predicted 2318
5 SASI_Mm01_00180481 predicted 1417
6 SASI_Mm01_00180482 predicted 2235
7 SASI_Mm01_00180483 predicted 1418
8 SASI_Mm01_00180484 predicted 2231
9 SASI_Mm01_00180485 predicted 1557
10 SASI_Mm01_00180486 predicted 1870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009462
VALIDATED
USP10 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 10
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-2353s21c1
Sequence:CCGGCCAAACGGTCAAGGTTATTAACTCGAGTTAATAACCTTGACCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-2866s21c1
Sequence:CCGGGTCATTAGAGATCGCTCTTACCTCGAGGTAAGAGCGATCTCTAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-2406s21c1
Sequence:CCGGGCACAGCCTACCTCCTATATTCTCGAGAATATAGGAGGTAGGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-1430s21c1
Sequence:CCGGCCCATGATAGATAGCTTTGTTCTCGAGAACAAAGCTATCTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-1621s21c1
Sequence:CCGGCGCAGAGGAGTATCTAGGTTTCTCGAGAAACCTAGATACTCCTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009462.1-1430s1c1
Sequence:CCGGCCCATGATAGATAGCTTTGTTCTCGAGAACAAAGCTATCTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009462.1-1621s1c1
Sequence:CCGGCGCAGAGGAGTATCTAGGTTTCTCGAGAAACCTAGATACTCCTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009462.1-340s1c1
Sequence:CCGGCCTTGGTTGTACGACTTCTAACTCGAGTTAGAAGTCGTACAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009462.1-1241s1c1
Sequence:CCGGGCAGAGTTATTGGAGACTGTACTCGAGTACAGTCTCCAATAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009462.1-2406s1c1
Sequence:CCGGGCACAGCCTACCTCCTATATTCTCGAGAATATAGGAGGTAGGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009462
VALIDATED
USP10 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 10
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-2353s21c1
Sequence:CCGGCCAAACGGTCAAGGTTATTAACTCGAGTTAATAACCTTGACCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-2866s21c1
Sequence:CCGGGTCATTAGAGATCGCTCTTACCTCGAGGTAAGAGCGATCTCTAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-2406s21c1
Sequence:CCGGGCACAGCCTACCTCCTATATTCTCGAGAATATAGGAGGTAGGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-1430s21c1
Sequence:CCGGCCCATGATAGATAGCTTTGTTCTCGAGAACAAAGCTATCTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-1621s21c1
Sequence:CCGGCGCAGAGGAGTATCTAGGTTTCTCGAGAAACCTAGATACTCCTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009462.1-1430s1c1
Sequence:CCGGCCCATGATAGATAGCTTTGTTCTCGAGAACAAAGCTATCTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009462.1-1621s1c1
Sequence:CCGGCGCAGAGGAGTATCTAGGTTTCTCGAGAAACCTAGATACTCCTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009462.1-340s1c1
Sequence:CCGGCCTTGGTTGTACGACTTCTAACTCGAGTTAGAAGTCGTACAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009462.1-1241s1c1
Sequence:CCGGGCAGAGTTATTGGAGACTGTACTCGAGTACAGTCTCCAATAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009462.1-2406s1c1
Sequence:CCGGGCACAGCCTACCTCCTATATTCTCGAGAATATAGGAGGTAGGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009462
VALIDATED
USP10 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 10
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-2353s21c1
Sequence:CCGGCCAAACGGTCAAGGTTATTAACTCGAGTTAATAACCTTGACCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-2866s21c1
Sequence:CCGGGTCATTAGAGATCGCTCTTACCTCGAGGTAAGAGCGATCTCTAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-2406s21c1
Sequence:CCGGGCACAGCCTACCTCCTATATTCTCGAGAATATAGGAGGTAGGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-1430s21c1
Sequence:CCGGCCCATGATAGATAGCTTTGTTCTCGAGAACAAAGCTATCTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009462.1-1621s21c1
Sequence:CCGGCGCAGAGGAGTATCTAGGTTTCTCGAGAAACCTAGATACTCCTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009462.1-1430s1c1
Sequence:CCGGCCCATGATAGATAGCTTTGTTCTCGAGAACAAAGCTATCTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009462.1-1621s1c1
Sequence:CCGGCGCAGAGGAGTATCTAGGTTTCTCGAGAAACCTAGATACTCCTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009462.1-340s1c1
Sequence:CCGGCCTTGGTTGTACGACTTCTAACTCGAGTTAGAAGTCGTACAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009462.1-1241s1c1
Sequence:CCGGGCAGAGTTATTGGAGACTGTACTCGAGTACAGTCTCCAATAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009462.1-2406s1c1
Sequence:CCGGGCACAGCCTACCTCCTATATTCTCGAGAATATAGGAGGTAGGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005153
VALIDATED
USP10 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005153.2-1586s21c1
Sequence:CCGGCGACAAGCTCTTGGAGATAAACTCGAGTTTATCTCCAAGAGCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005153.2-1307s21c1
Sequence:CCGGGAGGATCCTGTAGCCATAAAGCTCGAGCTTTATGGCTACAGGATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005153.2-2195s21c1
Sequence:CCGGCACCTGAAACGATTCGTTTATCTCGAGATAAACGAATCGTTTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005153.2-1215s21c1
Sequence:CCGGCCTATGTGGAAACTAAGTATTCTCGAGAATACTTAGTTTCCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005153.2-2868s21c1
Sequence:CCGGACCAGCAACAACACTTGTAAACTCGAGTTTACAAGTGTTGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005153.1-2577s1c1
Sequence:CCGGGCCTCTCTTTAGTGGCTCTTTCTCGAGAAAGAGCCACTAAAGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005153.1-1186s1c1
Sequence:CCGGCCTATGTGGAAACTAAGTATTCTCGAGAATACTTAGTTTCCACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005153.1-243s1c1
Sequence:CCGGGCTGTGGATAAACTACCTGATCTCGAGATCAGGTAGTTTATCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005153.1-1557s1c1
Sequence:CCGGCGACAAGCTCTTGGAGATAAACTCGAGTTTATCTCCAAGAGCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005153.1-1491s1c1
Sequence:CCGGCCCATGATAGACAGCTTTGTTCTCGAGAACAAAGCTGTCTATCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005153
VALIDATED
USP10 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005153.2-1586s21c1
Sequence:CCGGCGACAAGCTCTTGGAGATAAACTCGAGTTTATCTCCAAGAGCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005153.2-1307s21c1
Sequence:CCGGGAGGATCCTGTAGCCATAAAGCTCGAGCTTTATGGCTACAGGATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005153.2-2195s21c1
Sequence:CCGGCACCTGAAACGATTCGTTTATCTCGAGATAAACGAATCGTTTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005153.2-1215s21c1
Sequence:CCGGCCTATGTGGAAACTAAGTATTCTCGAGAATACTTAGTTTCCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005153.2-2868s21c1
Sequence:CCGGACCAGCAACAACACTTGTAAACTCGAGTTTACAAGTGTTGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005153.1-2577s1c1
Sequence:CCGGGCCTCTCTTTAGTGGCTCTTTCTCGAGAAAGAGCCACTAAAGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005153.1-1186s1c1
Sequence:CCGGCCTATGTGGAAACTAAGTATTCTCGAGAATACTTAGTTTCCACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005153.1-243s1c1
Sequence:CCGGGCTGTGGATAAACTACCTGATCTCGAGATCAGGTAGTTTATCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005153.1-1557s1c1
Sequence:CCGGCGACAAGCTCTTGGAGATAAACTCGAGTTTATCTCCAAGAGCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005153.1-1491s1c1
Sequence:CCGGCCCATGATAGACAGCTTTGTTCTCGAGAACAAAGCTGTCTATCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005153
VALIDATED
USP10 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005153.2-1586s21c1
Sequence:CCGGCGACAAGCTCTTGGAGATAAACTCGAGTTTATCTCCAAGAGCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005153.2-1307s21c1
Sequence:CCGGGAGGATCCTGTAGCCATAAAGCTCGAGCTTTATGGCTACAGGATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005153.2-2195s21c1
Sequence:CCGGCACCTGAAACGATTCGTTTATCTCGAGATAAACGAATCGTTTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005153.2-1215s21c1
Sequence:CCGGCCTATGTGGAAACTAAGTATTCTCGAGAATACTTAGTTTCCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005153.2-2868s21c1
Sequence:CCGGACCAGCAACAACACTTGTAAACTCGAGTTTACAAGTGTTGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005153.1-2577s1c1
Sequence:CCGGGCCTCTCTTTAGTGGCTCTTTCTCGAGAAAGAGCCACTAAAGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005153.1-1186s1c1
Sequence:CCGGCCTATGTGGAAACTAAGTATTCTCGAGAATACTTAGTTTCCACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005153.1-243s1c1
Sequence:CCGGGCTGTGGATAAACTACCTGATCTCGAGATCAGGTAGTTTATCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005153.1-1557s1c1
Sequence:CCGGCGACAAGCTCTTGGAGATAAACTCGAGTTTATCTCCAAGAGCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005153.1-1491s1c1
Sequence:CCGGCCCATGATAGACAGCTTTGTTCTCGAGAACAAAGCTGTCTATCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks