EMAIL THIS PAGE TO A FRIEND

USP11

ubiquitin specific peptidase 11

Synonyms: UHX1
UniProtKB ID: P51784, B2RTX1, Q8IUG6, Q9BWE1
Gene ID:
Human(8237) Summary: Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. This gene encodes a deubiquitinating enzyme which lies in a gene cluster on chromosome Xp11.23 [provided by RefSeq, Jul 2008]
Mouse(236733) ubiquitin specific peptidase 11
Rat(408217) ubiquitin specific peptidase 11
Zebrafish(568334) ubiquitin specific peptidase 11
Horse(100051171) ubiquitin specific peptidase 11
domestic cat(101096382) ubiquitin specific peptidase 11
dog(404014) ubiquitin specific peptidase 11
cow(538948) ubiquitin specific peptidase 11
sheep(101116378) ubiquitin specific peptidase 11
domestic guinea pig(100726894) ubiquitin specific peptidase 11
naked mole-rat(101720676) ubiquitin specific peptidase 11
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004651 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004651 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004651 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004651 Rosetta Predictions human pricing
NM_001008861 Rosetta Predictions rat pricing
NM_145628 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148685 predicted 2237
2 SASI_Hs01_00148686 predicted 645
3 SASI_Hs01_00148687 predicted 539
4 SASI_Hs01_00148688 predicted 1558
5 SASI_Hs01_00148689 predicted 1613
6 SASI_Hs01_00148690 predicted 410
7 SASI_Hs01_00148691 predicted 2199
8 SASI_Hs01_00148692 predicted 2666
9 SASI_Hs02_00338062 predicted 1348
10 SASI_Hs02_00338063 predicted 2239
11 SASI_Hs01_00148693 predicted 805
12 SASI_Hs01_00148694 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090037 predicted 1006
2 SASI_Rn01_00090038 predicted 408
3 SASI_Rn01_00090039 predicted 1756
4 SASI_Rn01_00090040 predicted 2492
5 SASI_Rn01_00090041 predicted 1408
6 SASI_Rn01_00090042 predicted 1576
7 SASI_Rn01_00090043 predicted 1661
8 SASI_Rn01_00090044 predicted 2522
9 SASI_Rn01_00090045 predicted 2143
10 SASI_Rn02_00199380 predicted 2729
11 SASI_Rn01_00090046 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341206 predicted 1712
2 SASI_Mm02_00341207 predicted 1255
3 SASI_Mm01_00130439 predicted 2540
4 SASI_Mm01_00130440 predicted 1460
5 SASI_Mm01_00130441 predicted 2571
6 SASI_Mm02_00341208 predicted 316
7 SASI_Mm02_00341209 predicted 2173
8 SASI_Mm02_00341210 predicted 1800
9 SASI_Mm02_00341211 predicted 435
10 SASI_Mm01_00130442 predicted 2635
11 SASI_Mm01_00130437 predicted 1144
12 SASI_Mm01_00130438 predicted 2159
13 SASI_Mm01_00130443 predicted 2141
14 SASI_Mm01_00130444 predicted 1290
15 SASI_Mm01_00130445 predicted 1471
16 SASI_Mm01_00130446 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004651
VALIDATED
USP11 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004651.2-3123s1c1
Sequence:CCGGCCCTCCCTTCTAGTCTTTATTCTCGAGAATAAAGACTAGAAGGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004651.2-1695s1c1
Sequence:CCGGCCGTGATGATATCTTCGTCTACTCGAGTAGACGAAGATATCATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004651.2-653s1c1
Sequence:CCGGCCGATTCTATTGGCCTAGTATCTCGAGATACTAGGCCAATAGAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004651.2-607s1c1
Sequence:CCGGCGGCACAATGATTTGGGCAAACTCGAGTTTGCCCAAATCATTGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004651.2-1800s1c1
Sequence:CCGGCCGTGACTACAACAACTCCTACTCGAGTAGGAGTTGTTGTAGTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004651.3-2624s21c1
Sequence:CCGGTCGCGGTTTCCAACCATTATGCTCGAGCATAATGGTTGGAAACCGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004651.3-1800s21c1
Sequence:CCGGCCGTGACTACAACAACTCCTACTCGAGTAGGAGTTGTTGTAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004651.3-653s21c1
Sequence:CCGGCCGATTCTATTGGCCTAGTATCTCGAGATACTAGGCCAATAGAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004651.3-1695s21c1
Sequence:CCGGCCGTGATGATATCTTCGTCTACTCGAGTAGACGAAGATATCATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004651
VALIDATED
USP11 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004651.2-3123s1c1
Sequence:CCGGCCCTCCCTTCTAGTCTTTATTCTCGAGAATAAAGACTAGAAGGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004651.2-1695s1c1
Sequence:CCGGCCGTGATGATATCTTCGTCTACTCGAGTAGACGAAGATATCATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004651.2-653s1c1
Sequence:CCGGCCGATTCTATTGGCCTAGTATCTCGAGATACTAGGCCAATAGAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004651.2-607s1c1
Sequence:CCGGCGGCACAATGATTTGGGCAAACTCGAGTTTGCCCAAATCATTGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004651.2-1800s1c1
Sequence:CCGGCCGTGACTACAACAACTCCTACTCGAGTAGGAGTTGTTGTAGTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004651.3-2624s21c1
Sequence:CCGGTCGCGGTTTCCAACCATTATGCTCGAGCATAATGGTTGGAAACCGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004651.3-1800s21c1
Sequence:CCGGCCGTGACTACAACAACTCCTACTCGAGTAGGAGTTGTTGTAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004651.3-653s21c1
Sequence:CCGGCCGATTCTATTGGCCTAGTATCTCGAGATACTAGGCCAATAGAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004651.3-1695s21c1
Sequence:CCGGCCGTGATGATATCTTCGTCTACTCGAGTAGACGAAGATATCATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004651
VALIDATED
USP11 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004651.2-3123s1c1
Sequence:CCGGCCCTCCCTTCTAGTCTTTATTCTCGAGAATAAAGACTAGAAGGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004651.2-1695s1c1
Sequence:CCGGCCGTGATGATATCTTCGTCTACTCGAGTAGACGAAGATATCATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004651.2-653s1c1
Sequence:CCGGCCGATTCTATTGGCCTAGTATCTCGAGATACTAGGCCAATAGAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004651.2-607s1c1
Sequence:CCGGCGGCACAATGATTTGGGCAAACTCGAGTTTGCCCAAATCATTGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004651.2-1800s1c1
Sequence:CCGGCCGTGACTACAACAACTCCTACTCGAGTAGGAGTTGTTGTAGTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004651.3-2624s21c1
Sequence:CCGGTCGCGGTTTCCAACCATTATGCTCGAGCATAATGGTTGGAAACCGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004651.3-1800s21c1
Sequence:CCGGCCGTGACTACAACAACTCCTACTCGAGTAGGAGTTGTTGTAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004651.3-653s21c1
Sequence:CCGGCCGATTCTATTGGCCTAGTATCTCGAGATACTAGGCCAATAGAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004651.3-1695s21c1
Sequence:CCGGCCGTGATGATATCTTCGTCTACTCGAGTAGACGAAGATATCATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145628
VALIDATED
USP11 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 11
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145628.2-1211s1c1
Sequence:CCGGGCAGAACCATAAACGACGAAACTCGAGTTTCGTCGTTTATGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145628.2-2514s1c1
Sequence:CCGGCCAGACCTCTACAAATATGATCTCGAGATCATATTTGTAGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145628.2-1285s1c1
Sequence:CCGGGCCCTGATTGTGGCAATGTTTCTCGAGAAACATTGCCACAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145628.2-2676s1c1
Sequence:CCGGGCAGCCTATGTCTTGTTCTATCTCGAGATAGAACAAGACATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145628.2-1699s1c1
Sequence:CCGGCCTACTATGGTCTGATACTTTCTCGAGAAAGTATCAGACCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145628.4-2535s21c1
Sequence:CCGGCCAGACCTCTACAAATATGATCTCGAGATCATATTTGTAGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145628.4-1720s21c1
Sequence:CCGGCCTACTATGGTCTGATACTTTCTCGAGAAAGTATCAGACCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145628.4-1306s21c1
Sequence:CCGGGCCCTGATTGTGGCAATGTTTCTCGAGAAACATTGCCACAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145628.4-1232s21c1
Sequence:CCGGGCAGAACCATAAACGACGAAACTCGAGTTTCGTCGTTTATGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145628
VALIDATED
USP11 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 11
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145628.2-1211s1c1
Sequence:CCGGGCAGAACCATAAACGACGAAACTCGAGTTTCGTCGTTTATGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145628.2-2514s1c1
Sequence:CCGGCCAGACCTCTACAAATATGATCTCGAGATCATATTTGTAGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145628.2-1285s1c1
Sequence:CCGGGCCCTGATTGTGGCAATGTTTCTCGAGAAACATTGCCACAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145628.2-2676s1c1
Sequence:CCGGGCAGCCTATGTCTTGTTCTATCTCGAGATAGAACAAGACATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145628.2-1699s1c1
Sequence:CCGGCCTACTATGGTCTGATACTTTCTCGAGAAAGTATCAGACCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145628.4-2535s21c1
Sequence:CCGGCCAGACCTCTACAAATATGATCTCGAGATCATATTTGTAGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145628.4-1720s21c1
Sequence:CCGGCCTACTATGGTCTGATACTTTCTCGAGAAAGTATCAGACCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145628.4-1306s21c1
Sequence:CCGGGCCCTGATTGTGGCAATGTTTCTCGAGAAACATTGCCACAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145628.4-1232s21c1
Sequence:CCGGGCAGAACCATAAACGACGAAACTCGAGTTTCGTCGTTTATGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145628
VALIDATED
USP11 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 11
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145628.2-1211s1c1
Sequence:CCGGGCAGAACCATAAACGACGAAACTCGAGTTTCGTCGTTTATGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145628.2-2514s1c1
Sequence:CCGGCCAGACCTCTACAAATATGATCTCGAGATCATATTTGTAGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145628.2-1285s1c1
Sequence:CCGGGCCCTGATTGTGGCAATGTTTCTCGAGAAACATTGCCACAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145628.2-2676s1c1
Sequence:CCGGGCAGCCTATGTCTTGTTCTATCTCGAGATAGAACAAGACATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145628.2-1699s1c1
Sequence:CCGGCCTACTATGGTCTGATACTTTCTCGAGAAAGTATCAGACCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145628.4-2535s21c1
Sequence:CCGGCCAGACCTCTACAAATATGATCTCGAGATCATATTTGTAGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145628.4-1720s21c1
Sequence:CCGGCCTACTATGGTCTGATACTTTCTCGAGAAAGTATCAGACCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145628.4-1306s21c1
Sequence:CCGGGCCCTGATTGTGGCAATGTTTCTCGAGAAACATTGCCACAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145628.4-1232s21c1
Sequence:CCGGGCAGAACCATAAACGACGAAACTCGAGTTTCGTCGTTTATGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks