EMAIL THIS PAGE TO A FRIEND

USP12

ubiquitin specific peptidase 12

Synonyms: UBH1 USP12L1
UniProtKB ID: O75317, A8K0X0, Q5VZV3, Q8TC49
Gene ID:
Mouse(22217) ubiquitin specific peptidase 12
Rat(360763) ubiquitin specific peptidase 12
naked mole-rat(101717899) ubiquitin specific peptidase 12
cow(525655) ubiquitin specific peptidase 12
sheep(101114370) ubiquitin specific peptidase 12
chicken(428078) ubiquitin specific peptidase 12
domestic cat(101097289) ubiquitin specific peptidase 12
dog(486033) ubiquitin specific peptidase 12
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300639 Anti-USP12 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1408437 Anti-USP12 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2103646 Anti-USP12 antibody produced in rabbit affinity isolated antibody rabbit, bovine, canine, zebrafish, mouse, guinea pig, human, rat, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182488 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011669 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011669 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011669 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146951 MISSION® esiRNA esiRNA human USP12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182488 Rosetta Predictions human pricing
XM_341033 Rosetta Predictions rat pricing
NM_011669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167303 predicted 918
2 SASI_Hs01_00167305 predicted 1306
3 SASI_Hs02_00370526 predicted 578
4 SASI_Hs01_00167306 predicted 1343
5 SASI_Hs01_00167307 predicted 710
6 SASI_Hs01_00167308 predicted 1052
7 SASI_Hs01_00167309 predicted 780
8 SASI_Hs01_00167310 predicted 516
9 SASI_Hs01_00167311 predicted 943
10 SASI_Hs01_00167312 predicted 1011
11 SASI_Hs01_00167304 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392270 predicted 1437
2 SASI_Rn02_00392271 predicted 1794
3 SASI_Rn02_00392272 predicted 1912
4 SASI_Rn02_00392273 predicted 1953
5 SASI_Rn02_00392274 predicted 1274
6 SASI_Rn02_00392275 predicted 1278
7 SASI_Rn02_00392276 predicted 1408
8 SASI_Rn02_00392277 predicted 1562
9 SASI_Rn02_00392278 predicted 1224
10 SASI_Rn02_00392279 predicted 1445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130592 predicted 1340
2 SASI_Mm01_00130593 predicted 685
3 SASI_Mm01_00130594 predicted 422
4 SASI_Mm01_00130595 predicted 820
5 SASI_Mm01_00130596 predicted 354
6 SASI_Mm01_00130597 predicted 697
7 SASI_Mm01_00130598 predicted 637
8 SASI_Mm02_00321183 predicted 1337
9 SASI_Mm02_00321184 predicted 657
10 SASI_Mm01_00130599 predicted 1381
11 SASI_Mm01_00130591 predicted 899
12 SASI_Mm01_00130600 predicted 1333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182488
VALIDATED
USP12 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182488.2-804s21c1
Sequence:CCGGCCAGATGTCTTACTTGTGAAACTCGAGTTTCACAAGTAAGACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182488.2-1094s21c1
Sequence:CCGGCCTTTAGAACTTCGTCTGTTTCTCGAGAAACAGACGAAGTTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182488.2-338s21c1
Sequence:CCGGCCAGAACAGTTTCCGGTCAATCTCGAGATTGACCGGAAACTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182488.2-1671s21c1
Sequence:CCGGGCACCAATAATGCTTTGAATTCTCGAGAATTCAAAGCATTATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-1676s1c1
Sequence:CCGGGCACCAATAATGCTTTGAATTCTCGAGAATTCAAAGCATTATTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-809s1c1
Sequence:CCGGCCAGATGTCTTACTTGTGAAACTCGAGTTTCACAAGTAAGACATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-1099s1c1
Sequence:CCGGCCTTTAGAACTTCGTCTGTTTCTCGAGAAACAGACGAAGTTCTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-343s1c1
Sequence:CCGGCCAGAACAGTTTCCGGTCAATCTCGAGATTGACCGGAAACTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-1144s1c1
Sequence:CCGGCCAGACAGAATGTACGACCTTCTCGAGAAGGTCGTACATTCTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182488
VALIDATED
USP12 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182488.2-804s21c1
Sequence:CCGGCCAGATGTCTTACTTGTGAAACTCGAGTTTCACAAGTAAGACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182488.2-1094s21c1
Sequence:CCGGCCTTTAGAACTTCGTCTGTTTCTCGAGAAACAGACGAAGTTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182488.2-338s21c1
Sequence:CCGGCCAGAACAGTTTCCGGTCAATCTCGAGATTGACCGGAAACTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182488.2-1671s21c1
Sequence:CCGGGCACCAATAATGCTTTGAATTCTCGAGAATTCAAAGCATTATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-1676s1c1
Sequence:CCGGGCACCAATAATGCTTTGAATTCTCGAGAATTCAAAGCATTATTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-809s1c1
Sequence:CCGGCCAGATGTCTTACTTGTGAAACTCGAGTTTCACAAGTAAGACATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-1099s1c1
Sequence:CCGGCCTTTAGAACTTCGTCTGTTTCTCGAGAAACAGACGAAGTTCTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-343s1c1
Sequence:CCGGCCAGAACAGTTTCCGGTCAATCTCGAGATTGACCGGAAACTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-1144s1c1
Sequence:CCGGCCAGACAGAATGTACGACCTTCTCGAGAAGGTCGTACATTCTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182488
VALIDATED
USP12 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182488.2-804s21c1
Sequence:CCGGCCAGATGTCTTACTTGTGAAACTCGAGTTTCACAAGTAAGACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182488.2-1094s21c1
Sequence:CCGGCCTTTAGAACTTCGTCTGTTTCTCGAGAAACAGACGAAGTTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182488.2-338s21c1
Sequence:CCGGCCAGAACAGTTTCCGGTCAATCTCGAGATTGACCGGAAACTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182488.2-1671s21c1
Sequence:CCGGGCACCAATAATGCTTTGAATTCTCGAGAATTCAAAGCATTATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-1676s1c1
Sequence:CCGGGCACCAATAATGCTTTGAATTCTCGAGAATTCAAAGCATTATTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-809s1c1
Sequence:CCGGCCAGATGTCTTACTTGTGAAACTCGAGTTTCACAAGTAAGACATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-1099s1c1
Sequence:CCGGCCTTTAGAACTTCGTCTGTTTCTCGAGAAACAGACGAAGTTCTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-343s1c1
Sequence:CCGGCCAGAACAGTTTCCGGTCAATCTCGAGATTGACCGGAAACTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_182488.1-1144s1c1
Sequence:CCGGCCAGACAGAATGTACGACCTTCTCGAGAAGGTCGTACATTCTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011669
VALIDATED
USP12 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011669.3-389s21c1
Sequence:CCGGTTCCGGTCAACGAGCACTATTCTCGAGAATAGTGCTCGTTGACCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011669.3-1653s21c1
Sequence:CCGGAGATACCAGCTCTCGTGTAAACTCGAGTTTACACGAGAGCTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011669.3-692s21c1
Sequence:CCGGTCAATACAATTGCTGATATTCCTCGAGGAATATCAGCAATTGTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011669.3-1229s21c1
Sequence:CCGGGTCCCAACCGAGGCCATTATACTCGAGTATAATGGCCTCGGTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011669.3-762s21c1
Sequence:CCGGAGACGTGGACAACGAGGATAACTCGAGTTATCCTCGTTGTCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011669.2-1113s1c1
Sequence:CCGGGCTTTCTTATCGCGTGGTCTTCTCGAGAAGACCACGCGATAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011669.2-636s1c1
Sequence:CCGGCGAGCTGTTTGACAACTACATCTCGAGATGTAGTTGTCAAACAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011669.2-449s1c1
Sequence:CCGGCAGTTCTTCAAGCACTTTATTCTCGAGAATAAAGTGCTTGAAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011669.2-923s1c1
Sequence:CCGGCATCAATTACTCACTGCTTAACTCGAGTTAAGCAGTGAGTAATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011669.2-1335s1c1
Sequence:CCGGCTACGGATTGACATCTGACATCTCGAGATGTCAGATGTCAATCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011669
VALIDATED
USP12 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011669.3-389s21c1
Sequence:CCGGTTCCGGTCAACGAGCACTATTCTCGAGAATAGTGCTCGTTGACCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011669.3-1653s21c1
Sequence:CCGGAGATACCAGCTCTCGTGTAAACTCGAGTTTACACGAGAGCTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011669.3-692s21c1
Sequence:CCGGTCAATACAATTGCTGATATTCCTCGAGGAATATCAGCAATTGTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011669.3-1229s21c1
Sequence:CCGGGTCCCAACCGAGGCCATTATACTCGAGTATAATGGCCTCGGTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011669.3-762s21c1
Sequence:CCGGAGACGTGGACAACGAGGATAACTCGAGTTATCCTCGTTGTCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011669.2-1113s1c1
Sequence:CCGGGCTTTCTTATCGCGTGGTCTTCTCGAGAAGACCACGCGATAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011669.2-636s1c1
Sequence:CCGGCGAGCTGTTTGACAACTACATCTCGAGATGTAGTTGTCAAACAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011669.2-449s1c1
Sequence:CCGGCAGTTCTTCAAGCACTTTATTCTCGAGAATAAAGTGCTTGAAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011669.2-923s1c1
Sequence:CCGGCATCAATTACTCACTGCTTAACTCGAGTTAAGCAGTGAGTAATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011669.2-1335s1c1
Sequence:CCGGCTACGGATTGACATCTGACATCTCGAGATGTCAGATGTCAATCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011669
VALIDATED
USP12 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011669.3-389s21c1
Sequence:CCGGTTCCGGTCAACGAGCACTATTCTCGAGAATAGTGCTCGTTGACCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011669.3-1653s21c1
Sequence:CCGGAGATACCAGCTCTCGTGTAAACTCGAGTTTACACGAGAGCTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011669.3-692s21c1
Sequence:CCGGTCAATACAATTGCTGATATTCCTCGAGGAATATCAGCAATTGTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011669.3-1229s21c1
Sequence:CCGGGTCCCAACCGAGGCCATTATACTCGAGTATAATGGCCTCGGTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011669.3-762s21c1
Sequence:CCGGAGACGTGGACAACGAGGATAACTCGAGTTATCCTCGTTGTCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011669.2-1113s1c1
Sequence:CCGGGCTTTCTTATCGCGTGGTCTTCTCGAGAAGACCACGCGATAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011669.2-636s1c1
Sequence:CCGGCGAGCTGTTTGACAACTACATCTCGAGATGTAGTTGTCAAACAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011669.2-449s1c1
Sequence:CCGGCAGTTCTTCAAGCACTTTATTCTCGAGAATAAAGTGCTTGAAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011669.2-923s1c1
Sequence:CCGGCATCAATTACTCACTGCTTAACTCGAGTTAAGCAGTGAGTAATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011669.2-1335s1c1
Sequence:CCGGCTACGGATTGACATCTGACATCTCGAGATGTCAGATGTCAATCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks