EMAIL THIS PAGE TO A FRIEND

USP13

ubiquitin specific peptidase 13 (isopeptidase T-3)

Synonyms: ISOT3 IsoT-3
UniProtKB ID: Q92995, A8K2S3, B4DYF3, D3DNS2, Q96B25
Gene ID:
Mouse(72607) ubiquitin specific peptidase 13 (isopeptidase T-3)
Rat(310306) ubiquitin specific peptidase 13
Zebrafish(558011) ubiquitin specific peptidase 13 (isopeptidase T-3)
dog(478640) ubiquitin specific peptidase 13 (isopeptidase T-3)
Horse(100065844) ubiquitin specific peptidase 13 (isopeptidase T-3)
domestic cat(101091353) ubiquitin specific peptidase 13 (isopeptidase T-3)
chicken(429286) ubiquitin specific peptidase 13 (isopeptidase T-3)
cow(100141289) ubiquitin specific peptidase 13 (isopeptidase T-3)
sheep(101107750) ubiquitin specific peptidase 13 (isopeptidase T-3)
domestic guinea pig(100712817) ubiquitin specific peptidase 13 (isopeptidase T-3)
naked mole-rat(101717563) ubiquitin specific peptidase 13 (isopeptidase T-3)
Domestic Rabbit(100346991) ubiquitin specific peptidase 13 (isopeptidase T-3)
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003940 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003940 Rosetta Predictions human pricing
NM_001107665 Rosetta Predictions rat pricing
NM_001013024 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108438 predicted 1819
2 SASI_Hs01_00108439 predicted 2512
3 SASI_Hs02_00336595 predicted 1072
4 SASI_Hs01_00108440 predicted 552
5 SASI_Hs01_00108441 predicted 2341
6 SASI_Hs01_00108442 predicted 1184
7 SASI_Hs01_00108444 predicted 2156
8 SASI_Hs01_00108445 predicted 1619
9 SASI_Hs01_00108446 predicted 454
10 SASI_Hs01_00108447 predicted 1015
11 SASI_Hs01_00108443 predicted 1996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231065 predicted 428
2 SASI_Rn02_00231066 predicted 524
3 SASI_Rn02_00231067 predicted 240
4 SASI_Rn02_00231068 predicted 1087
5 SASI_Rn02_00231069 predicted 1045
6 SASI_Rn02_00231070 predicted 2243
7 SASI_Rn02_00231071 predicted 893
8 SASI_Rn02_00231072 predicted 1572
9 SASI_Rn02_00231073 predicted 495
10 SASI_Rn02_00231074 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050831 predicted 1384
2 SASI_Mm01_00050832 predicted 1101
3 SASI_Mm01_00050833 predicted 645
4 SASI_Mm01_00050834 predicted 1056
5 SASI_Mm01_00050835 predicted 902
6 SASI_Mm01_00050836 predicted 539
7 SASI_Mm01_00050837 predicted 1045
8 SASI_Mm01_00050838 predicted 514
9 SASI_Mm01_00050839 predicted 431
10 SASI_Mm01_00050840 predicted 917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003940
VALIDATED
USP13 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 13 (isopeptidase T-3)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003940.1-1843s1c1
Sequence:CCGGGCAGATAAAGAAGTTCACTTTCTCGAGAAAGTGAACTTCTTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003940.1-1301s1c1
Sequence:CCGGCCGGTGAAATCTGAACTCATTCTCGAGAATGAGTTCAGATTTCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003940.1-652s1c1
Sequence:CCGGGCCAGTATCTAAATATGCCAACTCGAGTTGGCATATTTAGATACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003940.1-2018s1c1
Sequence:CCGGCGCCTGATGAACCAATTGATACTCGAGTATCAATTGGTTCATCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003940.1-466s1c1
Sequence:CCGGCGATTTAAATAGCGACGATTACTCGAGTAATCGTCGCTATTTAAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003940.2-1288s21c1
Sequence:CCGGCCGGTGAAATCTGAACTCATTCTCGAGAATGAGTTCAGATTTCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003940.2-1830s21c1
Sequence:CCGGGCAGATAAAGAAGTTCACTTTCTCGAGAAAGTGAACTTCTTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003940.2-639s21c1
Sequence:CCGGGCCAGTATCTAAATATGCCAACTCGAGTTGGCATATTTAGATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003940.2-453s21c1
Sequence:CCGGCGATTTAAATAGCGACGATTACTCGAGTAATCGTCGCTATTTAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003940
VALIDATED
USP13 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 13 (isopeptidase T-3)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003940.1-1843s1c1
Sequence:CCGGGCAGATAAAGAAGTTCACTTTCTCGAGAAAGTGAACTTCTTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003940.1-1301s1c1
Sequence:CCGGCCGGTGAAATCTGAACTCATTCTCGAGAATGAGTTCAGATTTCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003940.1-652s1c1
Sequence:CCGGGCCAGTATCTAAATATGCCAACTCGAGTTGGCATATTTAGATACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003940.1-2018s1c1
Sequence:CCGGCGCCTGATGAACCAATTGATACTCGAGTATCAATTGGTTCATCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003940.1-466s1c1
Sequence:CCGGCGATTTAAATAGCGACGATTACTCGAGTAATCGTCGCTATTTAAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003940.2-1288s21c1
Sequence:CCGGCCGGTGAAATCTGAACTCATTCTCGAGAATGAGTTCAGATTTCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003940.2-1830s21c1
Sequence:CCGGGCAGATAAAGAAGTTCACTTTCTCGAGAAAGTGAACTTCTTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003940.2-639s21c1
Sequence:CCGGGCCAGTATCTAAATATGCCAACTCGAGTTGGCATATTTAGATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003940.2-453s21c1
Sequence:CCGGCGATTTAAATAGCGACGATTACTCGAGTAATCGTCGCTATTTAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003940
VALIDATED
USP13 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 13 (isopeptidase T-3)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003940.1-1843s1c1
Sequence:CCGGGCAGATAAAGAAGTTCACTTTCTCGAGAAAGTGAACTTCTTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003940.1-1301s1c1
Sequence:CCGGCCGGTGAAATCTGAACTCATTCTCGAGAATGAGTTCAGATTTCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003940.1-652s1c1
Sequence:CCGGGCCAGTATCTAAATATGCCAACTCGAGTTGGCATATTTAGATACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003940.1-2018s1c1
Sequence:CCGGCGCCTGATGAACCAATTGATACTCGAGTATCAATTGGTTCATCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003940.1-466s1c1
Sequence:CCGGCGATTTAAATAGCGACGATTACTCGAGTAATCGTCGCTATTTAAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003940.2-1288s21c1
Sequence:CCGGCCGGTGAAATCTGAACTCATTCTCGAGAATGAGTTCAGATTTCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003940.2-1830s21c1
Sequence:CCGGGCAGATAAAGAAGTTCACTTTCTCGAGAAAGTGAACTTCTTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003940.2-639s21c1
Sequence:CCGGGCCAGTATCTAAATATGCCAACTCGAGTTGGCATATTTAGATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003940.2-453s21c1
Sequence:CCGGCGATTTAAATAGCGACGATTACTCGAGTAATCGTCGCTATTTAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013024
USP13 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 13 (isopeptidase T-3)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013024.1-1104s1c1
Sequence:CCGGGCAACAGTTGCTACCTCAGTTCTCGAGAACTGAGGTAGCAACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013024.1-4157s1c1
Sequence:CCGGCCTTTCATCTATGCCTCAGTTCTCGAGAACTGAGGCATAGATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013024.1-3926s1c1
Sequence:CCGGCGTACTTGTTTGATTGATCTTCTCGAGAAGATCAATCAAACAAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013024.1-2536s1c1
Sequence:CCGGCCATTATGTTTGCCATATCAACTCGAGTTGATATGGCAAACATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013024.1-2324s1c1
Sequence:CCGGGCAACGAATCATAACCTGGAACTCGAGTTCCAGGTTATGATTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013024
USP13 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 13 (isopeptidase T-3)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013024.1-1104s1c1
Sequence:CCGGGCAACAGTTGCTACCTCAGTTCTCGAGAACTGAGGTAGCAACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013024.1-4157s1c1
Sequence:CCGGCCTTTCATCTATGCCTCAGTTCTCGAGAACTGAGGCATAGATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013024.1-3926s1c1
Sequence:CCGGCGTACTTGTTTGATTGATCTTCTCGAGAAGATCAATCAAACAAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013024.1-2536s1c1
Sequence:CCGGCCATTATGTTTGCCATATCAACTCGAGTTGATATGGCAAACATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013024.1-2324s1c1
Sequence:CCGGGCAACGAATCATAACCTGGAACTCGAGTTCCAGGTTATGATTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013024
USP13 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 13 (isopeptidase T-3)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013024.1-1104s1c1
Sequence:CCGGGCAACAGTTGCTACCTCAGTTCTCGAGAACTGAGGTAGCAACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013024.1-4157s1c1
Sequence:CCGGCCTTTCATCTATGCCTCAGTTCTCGAGAACTGAGGCATAGATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013024.1-3926s1c1
Sequence:CCGGCGTACTTGTTTGATTGATCTTCTCGAGAAGATCAATCAAACAAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013024.1-2536s1c1
Sequence:CCGGCCATTATGTTTGCCATATCAACTCGAGTTGATATGGCAAACATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013024.1-2324s1c1
Sequence:CCGGGCAACGAATCATAACCTGGAACTCGAGTTCCAGGTTATGATTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks