EMAIL THIS PAGE TO A FRIEND

USP14

ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)

Synonyms: TGT
UniProtKB ID: P54578, J3QRZ5, Q53XY5
Gene ID:
Human(9097) Summary: This gene encodes a member of the ubiquitin-specific processing (UBP) family of proteases that is a deubiquitinating enzyme (DUB) with His and Cys domains. This protein is located in the cytoplasm and cleaves the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. Mice with a mutation that results in reduced expression of the ortholog of this protein are retarded for growth, develop severe tremors by 2 to 3 weeks of age followed by hindlimb paralysis and death by 6 to 10 weeks of age. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(59025) ubiquitin specific peptidase 14
Rat(291796) ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
Domestic Rabbit(100009078) ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
naked mole-rat(101710957) ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
domestic guinea pig(100719247) ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
cow(505106) ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
sheep(101121734) ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
Zebrafish(335736) ubiquitin specific protease 14 (tRNA-guanine transglycosylase)
domestic cat(101091976) ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
dog(480182) ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
chicken(421063) ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005151 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005151 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005151 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037334 Rosetta Predictions human pricing
NM_005151 Rosetta Predictions human pricing
NM_001008301 Rosetta Predictions rat pricing
NM_001038589 Rosetta Predictions mouse pricing
NM_021522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089059 predicted 1344
2 SASI_Hs01_00089060 predicted 1330
3 SASI_Hs01_00089061 predicted 1404
4 SASI_Hs01_00089062 predicted 1675
5 SASI_Hs01_00089063 predicted 621
6 SASI_Hs01_00089064 predicted 1393
7 SASI_Hs01_00089065 predicted 1224
8 SASI_Hs01_00089066 predicted 972
9 SASI_Hs01_00089067 predicted 687
10 SASI_Hs02_00308284 predicted 718
11 SASI_Hs01_00089068 predicted 1256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016087 predicted 1451
2 SASI_Hs01_00016089 predicted 1433
3 SASI_Hs01_00016090 predicted 1515
4 SASI_Hs01_00016091 predicted 1782
5 SASI_Hs01_00016092 predicted 1493
6 SASI_Hs01_00016093 predicted 1324
7 SASI_Hs01_00016094 predicted 1081
8 SASI_Hs01_00016095 predicted 790
9 SASI_Hs02_00339086 predicted 1401
10 SASI_Hs02_00339087 predicted 818
11 SASI_Hs01_00016088 predicted 1373
12 SASI_Hs01_00016096 predicted 1367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074026 predicted 380
2 SASI_Rn01_00074027 predicted 1342
3 SASI_Rn01_00074028 predicted 685
4 SASI_Rn02_00199016 predicted 1307
5 SASI_Rn02_00199017 predicted 771
6 SASI_Rn01_00074029 predicted 1345
7 SASI_Rn01_00074030 predicted 1079
8 SASI_Rn01_00074031 predicted 1272
9 SASI_Rn01_00074032 predicted 567
10 SASI_Rn01_00074033 predicted 1408
11 SASI_Rn01_00074034 predicted 706
12 SASI_Rn01_00074035 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137619 predicted 1069
2 SASI_Mm01_00137620 predicted 1162
3 SASI_Mm01_00137621 predicted 679
4 SASI_Mm01_00137622 predicted 1574
5 SASI_Mm01_00137623 predicted 757
6 SASI_Mm01_00137625 predicted 1345
7 SASI_Mm01_00137626 predicted 1266
8 SASI_Mm01_00137628 predicted 1413
9 SASI_Mm02_00289598 predicted 1608
10 SASI_Mm02_00289599 predicted 832
11 SASI_Mm01_00137624 predicted 1308
12 SASI_Mm01_00137627 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138912 predicted 1181
2 SASI_Mm01_00138913 predicted 1261
3 SASI_Mm01_00138914 predicted 781
4 SASI_Mm01_00138915 predicted 1688
5 SASI_Mm01_00138916 predicted 871
6 SASI_Mm01_00138918 predicted 1453
7 SASI_Mm01_00138919 predicted 1370
8 SASI_Mm01_00138921 predicted 1514
9 SASI_Mm02_00326249 predicted 1714
10 SASI_Mm02_00326250 predicted 935
11 SASI_Mm01_00138917 predicted 1410
12 SASI_Mm01_00138920 predicted 1141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021522
VALIDATED
USP14 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021522.4-821s21c1
Sequence:CCGGTAACGAATGCTGGATACAAATCTCGAGATTTGTATCCAGCATTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021522.4-723s21c1
Sequence:CCGGTCTAGTATCCCACCTATTATTCTCGAGAATAATAGGTGGGATACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021522.4-258s21c1
Sequence:CCGGGAGAAGTTTGAAGGTGTAGAACTCGAGTTCTACACCTTCAAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021522.4-2044s21c1
Sequence:CCGGTGCCTTATCTAACCAATATTTCTCGAGAAATATTGGTTAGATAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021522.4-1179s21c1
Sequence:CCGGCTACCTGCTTACTTAACTATTCTCGAGAATAGTTAAGTAAGCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021522.2-1842s1c1
Sequence:CCGGCCTTAGAAATTCTTGGCTGAACTCGAGTTCAGCCAAGAATTTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021522.2-610s1c1
Sequence:CCGGGCAGCTCTTAGAGATTTGTTTCTCGAGAAACAAATCTCTAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021522.2-187s1c1
Sequence:CCGGGAGAAGTTTGAAGGTGTAGAACTCGAGTTCTACACCTTCAAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021522.2-1111s1c1
Sequence:CCGGCCTGCTTACTTAACTATTCAACTCGAGTTGAATAGTTAAGTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021522.2-1330s1c1
Sequence:CCGGCCTCCGAAAGAGATTAAGTATCTCGAGATACTTAATCTCTTTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021522
VALIDATED
USP14 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021522.4-821s21c1
Sequence:CCGGTAACGAATGCTGGATACAAATCTCGAGATTTGTATCCAGCATTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021522.4-723s21c1
Sequence:CCGGTCTAGTATCCCACCTATTATTCTCGAGAATAATAGGTGGGATACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021522.4-258s21c1
Sequence:CCGGGAGAAGTTTGAAGGTGTAGAACTCGAGTTCTACACCTTCAAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021522.4-2044s21c1
Sequence:CCGGTGCCTTATCTAACCAATATTTCTCGAGAAATATTGGTTAGATAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021522.4-1179s21c1
Sequence:CCGGCTACCTGCTTACTTAACTATTCTCGAGAATAGTTAAGTAAGCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021522.2-1842s1c1
Sequence:CCGGCCTTAGAAATTCTTGGCTGAACTCGAGTTCAGCCAAGAATTTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021522.2-610s1c1
Sequence:CCGGGCAGCTCTTAGAGATTTGTTTCTCGAGAAACAAATCTCTAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021522.2-187s1c1
Sequence:CCGGGAGAAGTTTGAAGGTGTAGAACTCGAGTTCTACACCTTCAAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021522.2-1111s1c1
Sequence:CCGGCCTGCTTACTTAACTATTCAACTCGAGTTGAATAGTTAAGTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021522.2-1330s1c1
Sequence:CCGGCCTCCGAAAGAGATTAAGTATCTCGAGATACTTAATCTCTTTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021522
VALIDATED
USP14 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021522.4-821s21c1
Sequence:CCGGTAACGAATGCTGGATACAAATCTCGAGATTTGTATCCAGCATTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021522.4-723s21c1
Sequence:CCGGTCTAGTATCCCACCTATTATTCTCGAGAATAATAGGTGGGATACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021522.4-258s21c1
Sequence:CCGGGAGAAGTTTGAAGGTGTAGAACTCGAGTTCTACACCTTCAAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021522.4-2044s21c1
Sequence:CCGGTGCCTTATCTAACCAATATTTCTCGAGAAATATTGGTTAGATAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021522.4-1179s21c1
Sequence:CCGGCTACCTGCTTACTTAACTATTCTCGAGAATAGTTAAGTAAGCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021522.2-1842s1c1
Sequence:CCGGCCTTAGAAATTCTTGGCTGAACTCGAGTTCAGCCAAGAATTTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021522.2-610s1c1
Sequence:CCGGGCAGCTCTTAGAGATTTGTTTCTCGAGAAACAAATCTCTAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021522.2-187s1c1
Sequence:CCGGGAGAAGTTTGAAGGTGTAGAACTCGAGTTCTACACCTTCAAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021522.2-1111s1c1
Sequence:CCGGCCTGCTTACTTAACTATTCAACTCGAGTTGAATAGTTAAGTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021522.2-1330s1c1
Sequence:CCGGCCTCCGAAAGAGATTAAGTATCTCGAGATACTTAATCTCTTTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005151
VALIDATED
USP14 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005151.3-1663s21c1
Sequence:CCGGCGCAGAGTTGAAATAATGGAACTCGAGTTCCATTATTTCAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005151.3-2030s21c1
Sequence:CCGGCCCAAGATTCAGCAGTCAGATCTCGAGATCTGACTGCTGAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005151.3-543s21c1
Sequence:CCGGCCTTGGTAACACTTGTTACATCTCGAGATGTAACAAGTGTTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005151.3-676s21c1
Sequence:CCGGGCAGCCCTTAGAGATTTGTTTCTCGAGAAACAAATCTCTAAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-1298s1c1
Sequence:CCGGGCAGCCAAATACAAGTGACAACTCGAGTTGTCACTTGTATTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-473s1c1
Sequence:CCGGCCTTGGTAACACTTGTTACATCTCGAGATGTAACAAGTGTTACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-1593s1c1
Sequence:CCGGCGCAGAGTTGAAATAATGGAACTCGAGTTCCATTATTTCAACTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-1960s1c1
Sequence:CCGGCCCAAGATTCAGCAGTCAGATCTCGAGATCTGACTGCTGAATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-606s1c1
Sequence:CCGGGCAGCCCTTAGAGATTTGTTTCTCGAGAAACAAATCTCTAAGGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005151
VALIDATED
USP14 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005151.3-1663s21c1
Sequence:CCGGCGCAGAGTTGAAATAATGGAACTCGAGTTCCATTATTTCAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005151.3-2030s21c1
Sequence:CCGGCCCAAGATTCAGCAGTCAGATCTCGAGATCTGACTGCTGAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005151.3-543s21c1
Sequence:CCGGCCTTGGTAACACTTGTTACATCTCGAGATGTAACAAGTGTTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005151.3-676s21c1
Sequence:CCGGGCAGCCCTTAGAGATTTGTTTCTCGAGAAACAAATCTCTAAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-1298s1c1
Sequence:CCGGGCAGCCAAATACAAGTGACAACTCGAGTTGTCACTTGTATTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-473s1c1
Sequence:CCGGCCTTGGTAACACTTGTTACATCTCGAGATGTAACAAGTGTTACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-1593s1c1
Sequence:CCGGCGCAGAGTTGAAATAATGGAACTCGAGTTCCATTATTTCAACTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-1960s1c1
Sequence:CCGGCCCAAGATTCAGCAGTCAGATCTCGAGATCTGACTGCTGAATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-606s1c1
Sequence:CCGGGCAGCCCTTAGAGATTTGTTTCTCGAGAAACAAATCTCTAAGGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005151
VALIDATED
USP14 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005151.3-1663s21c1
Sequence:CCGGCGCAGAGTTGAAATAATGGAACTCGAGTTCCATTATTTCAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005151.3-2030s21c1
Sequence:CCGGCCCAAGATTCAGCAGTCAGATCTCGAGATCTGACTGCTGAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005151.3-543s21c1
Sequence:CCGGCCTTGGTAACACTTGTTACATCTCGAGATGTAACAAGTGTTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005151.3-676s21c1
Sequence:CCGGGCAGCCCTTAGAGATTTGTTTCTCGAGAAACAAATCTCTAAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-1298s1c1
Sequence:CCGGGCAGCCAAATACAAGTGACAACTCGAGTTGTCACTTGTATTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-473s1c1
Sequence:CCGGCCTTGGTAACACTTGTTACATCTCGAGATGTAACAAGTGTTACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-1593s1c1
Sequence:CCGGCGCAGAGTTGAAATAATGGAACTCGAGTTCCATTATTTCAACTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-1960s1c1
Sequence:CCGGCCCAAGATTCAGCAGTCAGATCTCGAGATCTGACTGCTGAATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005151.2-606s1c1
Sequence:CCGGGCAGCCCTTAGAGATTTGTTTCTCGAGAAACAAATCTCTAAGGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks