EMAIL THIS PAGE TO A FRIEND

USP15

ubiquitin specific peptidase 15

Synonyms: UNPH-2 UNPH4
UniProtKB ID: Q9Y4E8, Q08AL5, Q9H8G9, Q9HCA6, Q9UNP0, Q9Y5B5
Gene ID:
Human(9958) Summary: This gene encodes a member of the ubiquitin specific protease (USP) family of deubiquitinating enzymes. USP enzymes play critical roles in ubiquitin-dependent processes through polyubiquitin chain disassembly and hydrolysis of ubiquitin-substrate bonds. The encoded protein associates with the COP9 signalosome, and also plays a role in transforming growth factor beta signalling through deubiquitination of receptor-activated SMAD transcription factors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 2. [provided by RefSeq, Nov 2011]
Mouse(14479) ubiquitin specific peptidase 15
Rat(171329) ubiquitin specific peptidase 15
chicken(395644) ubiquitin specific peptidase 15
Horse(100055857) ubiquitin specific peptidase 15
domestic cat(101099566) ubiquitin specific peptidase 15
dog(474424) ubiquitin specific peptidase 15
cow(538284) ubiquitin specific peptidase 15
sheep(101113139) ubiquitin specific peptidase 15
domestic guinea pig(100734747) ubiquitin specific peptidase 15
naked mole-rat(101719900) ubiquitin specific peptidase 15
Domestic Rabbit(100356438) ubiquitin specific peptidase 15
199 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006313 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006313 Rosetta Predictions human pricing
NM_145184 Rosetta Predictions rat pricing
NM_027604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059894 predicted 1752
2 SASI_Hs01_00059895 predicted 469
3 SASI_Hs01_00059896 predicted 320
4 SASI_Hs01_00059897 predicted 2682
5 SASI_Hs01_00059898 predicted 2102
6 SASI_Hs01_00059899 predicted 445
7 SASI_Hs01_00059900 predicted 1542
8 SASI_Hs01_00059901 predicted 1201
9 SASI_Hs01_00059902 predicted 1380
10 SASI_Hs01_00059903 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031143 predicted 1764
2 SASI_Rn02_00268698 predicted 883
3 SASI_Rn01_00031144 predicted 278
4 SASI_Rn01_00031145 predicted 1117
5 SASI_Rn01_00031146 predicted 2510
6 SASI_Rn01_00031147 predicted 2489
7 SASI_Rn01_00031148 predicted 2229
8 SASI_Rn01_00031149 predicted 1362
9 SASI_Rn02_00268699 predicted 851
10 SASI_Rn01_00031151 predicted 1947
11 SASI_Rn01_00031150 predicted 1399
12 SASI_Rn01_00031152 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332453 predicted 2426
2 SASI_Mm01_00139615 predicted 244
3 SASI_Mm02_00332454 predicted 1149
4 SASI_Mm02_00332455 predicted 621
5 SASI_Mm01_00139616 predicted 442
6 SASI_Mm01_00139617 predicted 2540
7 SASI_Mm01_00139618 predicted 1838
8 SASI_Mm01_00139619 predicted 423
9 SASI_Mm01_00139621 predicted 2941
10 SASI_Mm01_00139622 predicted 1621
11 SASI_Mm01_00139613 predicted 1701
12 SASI_Mm01_00139614 predicted 948
13 SASI_Mm01_00139620 predicted 2582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027604
VALIDATED
USP15 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 15
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027604.2-2628s1c1
Sequence:CCGGCGCTATAATTTGATTGCTGTTCTCGAGAACAGCAATCAAATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027604.2-1644s1c1
Sequence:CCGGCGGGATGATATTTACGTGTTTCTCGAGAAACACGTAAATATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027604.2-2135s1c1
Sequence:CCGGGCGCTTGTTTACATTCCAGTTCTCGAGAACTGGAATGTAAACAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027604.2-1116s1c1
Sequence:CCGGGCACCTCAGTTCTCTGGATATCTCGAGATATCCAGAGAACTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027604.2-471s1c1
Sequence:CCGGGCTGACACAATAGATACGATTCTCGAGAATCGTATCTATTGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-2891s21c1
Sequence:CCGGTGACGAAGACAGCAATGATAACTCGAGTTATCATTGCTGTCTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-1009s21c1
Sequence:CCGGTGAGAGGTGAAATAGCTAAATCTCGAGATTTAGCTATTTCACCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-803s21c1
Sequence:CCGGCCCGTCATATACTGCTTATAACTCGAGTTATAAGCAGTATATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-539s21c1
Sequence:CCGGCAGACTGTGGAACAAGTATATCTCGAGATATACTTGTTCCACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231401    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-2997s21c1
Sequence:CCGGTGTCTATGGAGATGAAGTTATCTCGAGATAACTTCATCTCCATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027604
VALIDATED
USP15 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 15
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027604.2-2628s1c1
Sequence:CCGGCGCTATAATTTGATTGCTGTTCTCGAGAACAGCAATCAAATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027604.2-1644s1c1
Sequence:CCGGCGGGATGATATTTACGTGTTTCTCGAGAAACACGTAAATATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027604.2-2135s1c1
Sequence:CCGGGCGCTTGTTTACATTCCAGTTCTCGAGAACTGGAATGTAAACAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027604.2-1116s1c1
Sequence:CCGGGCACCTCAGTTCTCTGGATATCTCGAGATATCCAGAGAACTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027604.2-471s1c1
Sequence:CCGGGCTGACACAATAGATACGATTCTCGAGAATCGTATCTATTGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-2891s21c1
Sequence:CCGGTGACGAAGACAGCAATGATAACTCGAGTTATCATTGCTGTCTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-1009s21c1
Sequence:CCGGTGAGAGGTGAAATAGCTAAATCTCGAGATTTAGCTATTTCACCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-803s21c1
Sequence:CCGGCCCGTCATATACTGCTTATAACTCGAGTTATAAGCAGTATATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-539s21c1
Sequence:CCGGCAGACTGTGGAACAAGTATATCTCGAGATATACTTGTTCCACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231401    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-2997s21c1
Sequence:CCGGTGTCTATGGAGATGAAGTTATCTCGAGATAACTTCATCTCCATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027604
VALIDATED
USP15 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 15
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027604.2-2628s1c1
Sequence:CCGGCGCTATAATTTGATTGCTGTTCTCGAGAACAGCAATCAAATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027604.2-1644s1c1
Sequence:CCGGCGGGATGATATTTACGTGTTTCTCGAGAAACACGTAAATATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027604.2-2135s1c1
Sequence:CCGGGCGCTTGTTTACATTCCAGTTCTCGAGAACTGGAATGTAAACAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027604.2-1116s1c1
Sequence:CCGGGCACCTCAGTTCTCTGGATATCTCGAGATATCCAGAGAACTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027604.2-471s1c1
Sequence:CCGGGCTGACACAATAGATACGATTCTCGAGAATCGTATCTATTGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-2891s21c1
Sequence:CCGGTGACGAAGACAGCAATGATAACTCGAGTTATCATTGCTGTCTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-1009s21c1
Sequence:CCGGTGAGAGGTGAAATAGCTAAATCTCGAGATTTAGCTATTTCACCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-803s21c1
Sequence:CCGGCCCGTCATATACTGCTTATAACTCGAGTTATAAGCAGTATATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-539s21c1
Sequence:CCGGCAGACTGTGGAACAAGTATATCTCGAGATATACTTGTTCCACAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231401    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027604.3-2997s21c1
Sequence:CCGGTGTCTATGGAGATGAAGTTATCTCGAGATAACTTCATCTCCATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006313
VALIDATED
USP15 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 15
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006313.1-3391s1c1
Sequence:CCGGCCGTAATCAATGTGGGCCTATCTCGAGATAGGCCCACATTGATTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006313.1-1874s1c1
Sequence:CCGGGCTCACCAAGTGAAATGGAAACTCGAGTTTCCATTTCACTTGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006313.1-1346s1c1
Sequence:CCGGCCTTGGAAGTTTACTTAGTTACTCGAGTAACTAAGTAAACTTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006313.1-199s1c1
Sequence:CCGGCCCATTGATAACTCTGGACTTCTCGAGAAGTCCAGAGTTATCAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006313.1-1752s1c1
Sequence:CCGGGCTCTTGAGAATGTGCCGATACTCGAGTATCGGCACATTCTCAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006313.1-472s21c1
Sequence:CCGGGCTGACACAATAGATACAATTCTCGAGAATTGTATCTATTGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006313.1-923s21c1
Sequence:CCGGTGAGAGGTGAAATAGCTAAATCTCGAGATTTAGCTATTTCACCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006313.1-3327s21c1
Sequence:CCGGCAGTATCAATGTGGCATAAATCTCGAGATTTATGCCACATTGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006313.1-2530s21c1
Sequence:CCGGGCAGGTCCTTGCCGCTATAATCTCGAGATTATAGCGGCAAGGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006313.1-1603s21c1
Sequence:CCGGGATACAGAGCACGTGATTATTCTCGAGAATAATCACGTGCTCTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006313.1-717s21c1
Sequence:CCGGTCCATCATATACCGCTTATAACTCGAGTTATAAGCGGTATATGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006313.1-446s21c1
Sequence:CCGGATGTTGTAACTCGAAGATTTACTCGAGTAAATCTTCGAGTTACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006313.1-853s21c1
Sequence:CCGGCCTCCACTTACTGAGTATTTCCTCGAGGAAATACTCAGTAAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006313.1-3287s21c1
Sequence:CCGGTGCATTAGGCTGCCGTATATACTCGAGTATATACGGCAGCCTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006313.1-3200s21c1
Sequence:CCGGATTTGTGGATGTTGGTCATTTCTCGAGAAATGACCAACATCCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006313
VALIDATED
USP15 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 15
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006313.1-3391s1c1
Sequence:CCGGCCGTAATCAATGTGGGCCTATCTCGAGATAGGCCCACATTGATTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006313.1-1874s1c1
Sequence:CCGGGCTCACCAAGTGAAATGGAAACTCGAGTTTCCATTTCACTTGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006313.1-1346s1c1
Sequence:CCGGCCTTGGAAGTTTACTTAGTTACTCGAGTAACTAAGTAAACTTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006313.1-199s1c1
Sequence:CCGGCCCATTGATAACTCTGGACTTCTCGAGAAGTCCAGAGTTATCAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006313.1-1752s1c1
Sequence:CCGGGCTCTTGAGAATGTGCCGATACTCGAGTATCGGCACATTCTCAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006313.1-472s21c1
Sequence:CCGGGCTGACACAATAGATACAATTCTCGAGAATTGTATCTATTGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006313.1-923s21c1
Sequence:CCGGTGAGAGGTGAAATAGCTAAATCTCGAGATTTAGCTATTTCACCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006313.1-3327s21c1
Sequence:CCGGCAGTATCAATGTGGCATAAATCTCGAGATTTATGCCACATTGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006313.1-2530s21c1
Sequence:CCGGGCAGGTCCTTGCCGCTATAATCTCGAGATTATAGCGGCAAGGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006313.1-1603s21c1
Sequence:CCGGGATACAGAGCACGTGATTATTCTCGAGAATAATCACGTGCTCTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006313.1-717s21c1
Sequence:CCGGTCCATCATATACCGCTTATAACTCGAGTTATAAGCGGTATATGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006313.1-446s21c1
Sequence:CCGGATGTTGTAACTCGAAGATTTACTCGAGTAAATCTTCGAGTTACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006313.1-853s21c1
Sequence:CCGGCCTCCACTTACTGAGTATTTCCTCGAGGAAATACTCAGTAAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006313.1-3287s21c1
Sequence:CCGGTGCATTAGGCTGCCGTATATACTCGAGTATATACGGCAGCCTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006313.1-3200s21c1
Sequence:CCGGATTTGTGGATGTTGGTCATTTCTCGAGAAATGACCAACATCCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006313
VALIDATED
USP15 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 15
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006313.1-3391s1c1
Sequence:CCGGCCGTAATCAATGTGGGCCTATCTCGAGATAGGCCCACATTGATTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006313.1-1874s1c1
Sequence:CCGGGCTCACCAAGTGAAATGGAAACTCGAGTTTCCATTTCACTTGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006313.1-1346s1c1
Sequence:CCGGCCTTGGAAGTTTACTTAGTTACTCGAGTAACTAAGTAAACTTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006313.1-199s1c1
Sequence:CCGGCCCATTGATAACTCTGGACTTCTCGAGAAGTCCAGAGTTATCAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006313.1-1752s1c1
Sequence:CCGGGCTCTTGAGAATGTGCCGATACTCGAGTATCGGCACATTCTCAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006313.1-472s21c1
Sequence:CCGGGCTGACACAATAGATACAATTCTCGAGAATTGTATCTATTGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006313.1-923s21c1
Sequence:CCGGTGAGAGGTGAAATAGCTAAATCTCGAGATTTAGCTATTTCACCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006313.1-3327s21c1
Sequence:CCGGCAGTATCAATGTGGCATAAATCTCGAGATTTATGCCACATTGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006313.1-2530s21c1
Sequence:CCGGGCAGGTCCTTGCCGCTATAATCTCGAGATTATAGCGGCAAGGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006313.1-1603s21c1
Sequence:CCGGGATACAGAGCACGTGATTATTCTCGAGAATAATCACGTGCTCTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006313.1-717s21c1
Sequence:CCGGTCCATCATATACCGCTTATAACTCGAGTTATAAGCGGTATATGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006313.1-446s21c1
Sequence:CCGGATGTTGTAACTCGAAGATTTACTCGAGTAAATCTTCGAGTTACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006313.1-853s21c1
Sequence:CCGGCCTCCACTTACTGAGTATTTCCTCGAGGAAATACTCAGTAAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006313.1-3287s21c1
Sequence:CCGGTGCATTAGGCTGCCGTATATACTCGAGTATATACGGCAGCCTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006313.1-3200s21c1
Sequence:CCGGATTTGTGGATGTTGGTCATTTCTCGAGAAATGACCAACATCCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks