EMAIL THIS PAGE TO A FRIEND

USP16

ubiquitin specific peptidase 16

Synonyms: UBP-M
Gene ID:
Human(10600) Summary: This gene encodes a deubiquitinating enzyme that is phosphorylated at the onset of mitosis and then dephosphorylated at the metaphase/anaphase transition. It can deubiquitinate H2A, one of two major ubiquitinated proteins of chromatin, in vitro and a mutant form of the protein was shown to block cell division. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(74112) ubiquitin specific peptidase 16
Rat(288306) ubiquitin specific peptidase 16
Domestic Rabbit(100353041) ubiquitin specific peptidase 16
naked mole-rat(101703447) ubiquitin specific peptidase 16
domestic guinea pig(100713735) ubiquitin specific peptidase 16
cow(519992) ubiquitin specific peptidase 16
sheep(101109404) ubiquitin specific peptidase 16
Zebrafish(569700) ubiquitin specific protease 16
domestic cat(101098481) ubiquitin specific peptidase 16
dog(478398) ubiquitin specific peptidase 16
chicken(418485) ubiquitin specific peptidase 16
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006447 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024258 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024258 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024258 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001992 Rosetta Predictions human pricing
NM_001032410 Rosetta Predictions human pricing
NM_006447 Rosetta Predictions human pricing
XM_001066902 Rosetta Predictions rat pricing
XM_213676 Rosetta Predictions rat pricing
NM_024258 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210886 predicted 1263
2 SASI_Hs02_00304059 predicted 2125
3 SASI_Hs01_00210887 predicted 2417
4 SASI_Hs01_00210889 predicted 2612
5 SASI_Hs01_00210890 predicted 1542
6 SASI_Hs01_00210891 predicted 2530
7 SASI_Hs02_00304060 predicted 2173
8 SASI_Hs01_00210892 predicted 2622
9 SASI_Hs01_00210893 predicted 1821
10 SASI_Hs01_00210894 predicted 1974
11 SASI_Hs01_00210888 predicted 2185
12 SASI_Hs01_00210895 predicted 2212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132304 predicted 1332
2 SASI_Hs02_00307953 predicted 2188
3 SASI_Hs01_00132305 predicted 2484
4 SASI_Hs01_00132307 predicted 2674
5 SASI_Hs01_00132308 predicted 1616
6 SASI_Hs01_00132309 predicted 2593
7 SASI_Hs02_00307954 predicted 2241
8 SASI_Hs01_00132310 predicted 2684
9 SASI_Hs01_00132311 predicted 1881
10 SASI_Hs01_00132312 predicted 2048
11 SASI_Hs01_00132306 predicted 2249
12 SASI_Hs01_00132313 predicted 2273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121496 predicted 1271
2 SASI_Hs02_00341586 predicted 2129
3 SASI_Hs01_00121497 predicted 2420
4 SASI_Hs01_00121499 predicted 2611
5 SASI_Hs01_00121500 predicted 1548
6 SASI_Hs01_00121501 predicted 2527
7 SASI_Hs02_00341587 predicted 2180
8 SASI_Hs01_00121502 predicted 2621
9 SASI_Hs01_00121503 predicted 1826
10 SASI_Hs01_00121504 predicted 1983
11 SASI_Hs01_00121498 predicted 2185
12 SASI_Hs01_00121505 predicted 2210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319152 predicted 2562
2 SASI_Rn02_00319153 predicted 2238
3 SASI_Rn02_00319154 predicted 198
4 SASI_Rn02_00319155 predicted 259
5 SASI_Rn02_00319156 predicted 1903
6 SASI_Rn02_00319157 predicted 2359
7 SASI_Rn02_00319158 predicted 1851
8 SASI_Rn02_00319159 predicted 2509
9 SASI_Rn02_00319160 predicted 2219
10 SASI_Rn02_00319161 predicted 2112
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374816 predicted 2565
2 SASI_Rn02_00374817 predicted 2240
3 SASI_Rn02_00374818 predicted 2701
4 SASI_Rn02_00374819 predicted 202
5 SASI_Rn02_00374820 predicted 257
6 SASI_Rn02_00374821 predicted 1902
7 SASI_Rn02_00374822 predicted 2355
8 SASI_Rn02_00374823 predicted 1852
9 SASI_Rn02_00374824 predicted 2513
10 SASI_Rn02_00374825 predicted 2215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105191 predicted 737
2 SASI_Mm02_00327647 predicted 1168
3 SASI_Mm02_00327648 predicted 1703
4 SASI_Mm01_00105193 predicted 1977
5 SASI_Mm01_00105194 predicted 793
6 SASI_Mm02_00327649 predicted 1958
7 SASI_Mm01_00105197 predicted 1428
8 SASI_Mm02_00327650 predicted 2433
9 SASI_Mm01_00105199 predicted 2315
10 SASI_Mm01_00105200 predicted 2179
11 SASI_Mm01_00105192 predicted 1857
12 SASI_Mm01_00105195 predicted 436
13 SASI_Mm01_00105196 predicted 1744
14 SASI_Mm01_00105198 predicted 1876
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006447
USP16 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 16
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006447.2-2444s21c1
Sequence:CCGGGTTGAACACAGTGGTACTATGCTCGAGCATAGTACCACTGTGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006447.2-2719s21c1
Sequence:CCGGTAATGGCTGAAATAACGATAACTCGAGTTATCGTTATTTCAGCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006447.2-2112s21c1
Sequence:CCGGTATATCAGTTCACCCGTAATGCTCGAGCATTACGGGTGAACTGATATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006447.2-2188s21c1
Sequence:CCGGTAATGGACCAAAGGCAAATATCTCGAGATATTTGCCTTTGGTCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006447.2-350s21c1
Sequence:CCGGGACTGTAAGACTGACAATAAACTCGAGTTTATTGTCAGTCTTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006447.1-2709s1c1
Sequence:CCGGGCCAGAAGAAATCATGTTTATCTCGAGATAAACATGATTTCTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006447.1-2073s1c1
Sequence:CCGGGCGAATAAACTGCTTTGTGAACTCGAGTTCACAAAGCAGTTTATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006447.1-2462s1c1
Sequence:CCGGCGGTGATATTCCACAAGATTTCTCGAGAAATCTTGTGGAATATCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006447.1-2540s1c1
Sequence:CCGGGCCTACAACTAAAGTACTAAACTCGAGTTTAGTACTTTAGTTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006447.1-1479s1c1
Sequence:CCGGGCCAAGAACCAACGAAGACAACTCGAGTTGTCTTCGTTGGTTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006447
USP16 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 16
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006447.2-2444s21c1
Sequence:CCGGGTTGAACACAGTGGTACTATGCTCGAGCATAGTACCACTGTGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006447.2-2719s21c1
Sequence:CCGGTAATGGCTGAAATAACGATAACTCGAGTTATCGTTATTTCAGCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006447.2-2112s21c1
Sequence:CCGGTATATCAGTTCACCCGTAATGCTCGAGCATTACGGGTGAACTGATATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006447.2-2188s21c1
Sequence:CCGGTAATGGACCAAAGGCAAATATCTCGAGATATTTGCCTTTGGTCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006447.2-350s21c1
Sequence:CCGGGACTGTAAGACTGACAATAAACTCGAGTTTATTGTCAGTCTTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006447.1-2709s1c1
Sequence:CCGGGCCAGAAGAAATCATGTTTATCTCGAGATAAACATGATTTCTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006447.1-2073s1c1
Sequence:CCGGGCGAATAAACTGCTTTGTGAACTCGAGTTCACAAAGCAGTTTATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006447.1-2462s1c1
Sequence:CCGGCGGTGATATTCCACAAGATTTCTCGAGAAATCTTGTGGAATATCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006447.1-2540s1c1
Sequence:CCGGGCCTACAACTAAAGTACTAAACTCGAGTTTAGTACTTTAGTTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006447.1-1479s1c1
Sequence:CCGGGCCAAGAACCAACGAAGACAACTCGAGTTGTCTTCGTTGGTTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006447
USP16 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 16
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006447.2-2444s21c1
Sequence:CCGGGTTGAACACAGTGGTACTATGCTCGAGCATAGTACCACTGTGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006447.2-2719s21c1
Sequence:CCGGTAATGGCTGAAATAACGATAACTCGAGTTATCGTTATTTCAGCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006447.2-2112s21c1
Sequence:CCGGTATATCAGTTCACCCGTAATGCTCGAGCATTACGGGTGAACTGATATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006447.2-2188s21c1
Sequence:CCGGTAATGGACCAAAGGCAAATATCTCGAGATATTTGCCTTTGGTCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006447.2-350s21c1
Sequence:CCGGGACTGTAAGACTGACAATAAACTCGAGTTTATTGTCAGTCTTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006447.1-2709s1c1
Sequence:CCGGGCCAGAAGAAATCATGTTTATCTCGAGATAAACATGATTTCTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006447.1-2073s1c1
Sequence:CCGGGCGAATAAACTGCTTTGTGAACTCGAGTTCACAAAGCAGTTTATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006447.1-2462s1c1
Sequence:CCGGCGGTGATATTCCACAAGATTTCTCGAGAAATCTTGTGGAATATCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006447.1-2540s1c1
Sequence:CCGGGCCTACAACTAAAGTACTAAACTCGAGTTTAGTACTTTAGTTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006447.1-1479s1c1
Sequence:CCGGGCCAAGAACCAACGAAGACAACTCGAGTTGTCTTCGTTGGTTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024258
VALIDATED
USP16 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 16
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.1-2646s21c1
Sequence:CCGGTTATGTTCACCTAAGTAAATGCTCGAGCATTTACTTAGGTGAACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.1-1950s21c1
Sequence:CCGGTCGCGAACCGAGAAGCGTTTACTCGAGTAAACGCTTCTCGGTTCGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.1-480s21c1
Sequence:CCGGGCCAAGTGGTTGATTATGTTACTCGAGTAACATAATCAACCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.1-2306s21c1
Sequence:CCGGCGAGTGCTGTATTCCTTATATCTCGAGATATAAGGAATACAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024258.1-1033s21c1
Sequence:CCGGCCAAAGAGTGAGTAAAGGAATCTCGAGATTCCTTTACTCACTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.2-2652s21c1
Sequence:CCGGTTCTCTGGAAATACACCTATGCTCGAGCATAGGTGTATTTCCAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-2036s1c1
Sequence:CCGGGCCAATAAACTGCTTTGTGAACTCGAGTTCACAAAGCAGTTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-1033s1c1
Sequence:CCGGCCAAAGAGTGAGTAAAGGAATCTCGAGATTCCTTTACTCACTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-2306s1c1
Sequence:CCGGCGAGTGCTGTATTCCTTATATCTCGAGATATAAGGAATACAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-1791s1c1
Sequence:CCGGCCAGTGGAGAACTAGACATTACTCGAGTAATGTCTAGTTCTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-480s1c1
Sequence:CCGGGCCAAGTGGTTGATTATGTTACTCGAGTAACATAATCAACCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024258
VALIDATED
USP16 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 16
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.1-2646s21c1
Sequence:CCGGTTATGTTCACCTAAGTAAATGCTCGAGCATTTACTTAGGTGAACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.1-1950s21c1
Sequence:CCGGTCGCGAACCGAGAAGCGTTTACTCGAGTAAACGCTTCTCGGTTCGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.1-480s21c1
Sequence:CCGGGCCAAGTGGTTGATTATGTTACTCGAGTAACATAATCAACCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.1-2306s21c1
Sequence:CCGGCGAGTGCTGTATTCCTTATATCTCGAGATATAAGGAATACAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024258.1-1033s21c1
Sequence:CCGGCCAAAGAGTGAGTAAAGGAATCTCGAGATTCCTTTACTCACTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.2-2652s21c1
Sequence:CCGGTTCTCTGGAAATACACCTATGCTCGAGCATAGGTGTATTTCCAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-2036s1c1
Sequence:CCGGGCCAATAAACTGCTTTGTGAACTCGAGTTCACAAAGCAGTTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-1033s1c1
Sequence:CCGGCCAAAGAGTGAGTAAAGGAATCTCGAGATTCCTTTACTCACTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-2306s1c1
Sequence:CCGGCGAGTGCTGTATTCCTTATATCTCGAGATATAAGGAATACAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-1791s1c1
Sequence:CCGGCCAGTGGAGAACTAGACATTACTCGAGTAATGTCTAGTTCTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-480s1c1
Sequence:CCGGGCCAAGTGGTTGATTATGTTACTCGAGTAACATAATCAACCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024258
VALIDATED
USP16 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 16
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.1-2646s21c1
Sequence:CCGGTTATGTTCACCTAAGTAAATGCTCGAGCATTTACTTAGGTGAACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.1-1950s21c1
Sequence:CCGGTCGCGAACCGAGAAGCGTTTACTCGAGTAAACGCTTCTCGGTTCGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.1-480s21c1
Sequence:CCGGGCCAAGTGGTTGATTATGTTACTCGAGTAACATAATCAACCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.1-2306s21c1
Sequence:CCGGCGAGTGCTGTATTCCTTATATCTCGAGATATAAGGAATACAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024258.1-1033s21c1
Sequence:CCGGCCAAAGAGTGAGTAAAGGAATCTCGAGATTCCTTTACTCACTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024258.2-2652s21c1
Sequence:CCGGTTCTCTGGAAATACACCTATGCTCGAGCATAGGTGTATTTCCAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-2036s1c1
Sequence:CCGGGCCAATAAACTGCTTTGTGAACTCGAGTTCACAAAGCAGTTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-1033s1c1
Sequence:CCGGCCAAAGAGTGAGTAAAGGAATCTCGAGATTCCTTTACTCACTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-2306s1c1
Sequence:CCGGCGAGTGCTGTATTCCTTATATCTCGAGATATAAGGAATACAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-1791s1c1
Sequence:CCGGCCAGTGGAGAACTAGACATTACTCGAGTAATGTCTAGTTCTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024258.1-480s1c1
Sequence:CCGGGCCAAGTGGTTGATTATGTTACTCGAGTAACATAATCAACCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks