EMAIL THIS PAGE TO A FRIEND

USP17L1P

ubiquitin specific peptidase 17-like family member 1, pseudogene

Synonyms: USP17L1
Species: Human USP17L1P(401447)
UniProtKB ID: Q7RTZ2
Gene ID:
8 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001324 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_040280 Rosetta Predictions human pricing
XR_040281 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517496 predicted 1064
2 SASI_Hs02_00517497 predicted 1179
3 SASI_Hs02_00517498 predicted 1175
4 SASI_Hs02_00517499 predicted 45
5 SASI_Hs02_00517500 predicted 116
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517501 predicted 751
2 SASI_Hs02_00517502 predicted 855
3 SASI_Hs02_00517503 predicted 856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001324
USP17L1P MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 17-like family member 1, pseudogene
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000073790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001324.1-471s1c1
Sequence:CCGGGCAGGAAGATGTCCATGAATTCTCGAGAATTCATGGACATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001324.1-630s1c1
Sequence:CCGGCCACGGGATTTCAGACACTTTCTCGAGAAAGTGTCTGAAATCCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001324.1-993s1c1
Sequence:CCGGCGACGGACATTACTTCTCCTACTCGAGTAGGAGAAGTAATGTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001324.1-1381s1c1
Sequence:CCGGCCCAACGCACTTGTGATTCATCTCGAGATGAATCACAAGTGCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001324
USP17L1P MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 17-like family member 1, pseudogene
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000073790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001324.1-471s1c1
Sequence:CCGGGCAGGAAGATGTCCATGAATTCTCGAGAATTCATGGACATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001324.1-630s1c1
Sequence:CCGGCCACGGGATTTCAGACACTTTCTCGAGAAAGTGTCTGAAATCCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001324.1-993s1c1
Sequence:CCGGCGACGGACATTACTTCTCCTACTCGAGTAGGAGAAGTAATGTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001324.1-1381s1c1
Sequence:CCGGCCCAACGCACTTGTGATTCATCTCGAGATGAATCACAAGTGCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001324
USP17L1P MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 17-like family member 1, pseudogene
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000073790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001324.1-471s1c1
Sequence:CCGGGCAGGAAGATGTCCATGAATTCTCGAGAATTCATGGACATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001324.1-630s1c1
Sequence:CCGGCCACGGGATTTCAGACACTTTCTCGAGAAAGTGTCTGAAATCCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001324.1-993s1c1
Sequence:CCGGCGACGGACATTACTTCTCCTACTCGAGTAGGAGAAGTAATGTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001324.1-1381s1c1
Sequence:CCGGCCCAACGCACTTGTGATTCATCTCGAGATGAATCACAAGTGCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks