EMAIL THIS PAGE TO A FRIEND

USP17L2

ubiquitin specific peptidase 17-like family member 2

Synonyms: DUB-3 DUB3 USP17
Species: Human USP17L2(377630)
UniProtKB ID: Q6R6M4
Gene ID:
Human(377630) Summary: DUB3 is a member of the ubiquitin processing protease (UBP) subfamily of deubiquitinating enzymes. See USP1 (MIM 603478) for background information.[supplied by OMIM, Mar 2008]
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201402 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU228771 MISSION® esiRNA esiRNA targeting human USP17L2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_201402 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372940 predicted 743
2 SASI_Hs02_00372941 predicted 860
3 SASI_Hs02_00372942 predicted 859
4 SASI_Hs02_00372943 predicted 1478
5 SASI_Hs01_00221912 predicted 1312
6 SASI_Hs01_00221913 predicted 537
7 SASI_Hs01_00221914 predicted 1217
8 SASI_Hs01_00221915 predicted 1299
9 SASI_Hs01_00221916 predicted 1346
10 SASI_Hs01_00221917 predicted 1314
11 SASI_Hs01_00221918 predicted 1286
12 SASI_Hs01_00221919 predicted 1268
13 SASI_Hs01_00221920 predicted 1300
14 SASI_Hs01_00221921 predicted 1281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201402
VALIDATED
USP17L2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 17-like family member 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_201402.1-1381s1c1
Sequence:CCGGCCCGACGTACTTGTGATTCATCTCGAGATGAATCACAAGTACGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_201402.1-1341s1c1
Sequence:CCGGGCCTGAGTTCAACGTCAGAAACTCGAGTTTCTGACGTTGAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201402.1-940s1c1
Sequence:CCGGCCTCTTGTCTATGTCCTCTATCTCGAGATAGAGGACATAGACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_201402.1-471s1c1
Sequence:CCGGGCAGGAAGATGCCCATGAATTCTCGAGAATTCATGGGCATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201402.1-1295s1c1
Sequence:CCGGGCACCTTAGACCACTGGAAATCTCGAGATTTCCAGTGGTCTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-568s21c1
Sequence:CCGGACCACCCTCATCCACCAAATACTCGAGTATTTGGTGGATGAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-984s21c1
Sequence:CCGGGAGTTGTCACGACGGACATTACTCGAGTAATGTCCGTCGTGACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-1023s21c1
Sequence:CCGGTCAAGAAGGCCAGTGGTATAACTCGAGTTATACCACTGGCCTTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-144s21c1
Sequence:CCGGTGTCGACCTCTGTGATGATTTCTCGAGAAATCATCACAGAGGTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-787s21c1
Sequence:CCGGGCCTCCAAGACGTTAACTTTACTCGAGTAAAGTTAACGTCTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-851s21c1
Sequence:CCGGCCGATGTCACAGGCAACAAACCTCGAGGTTTGTTGCCTGTGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_201402.2-750s21c1
Sequence:CCGGTGCCTATCATTGCGGTCTTTGCTCGAGCAAAGACCGCAATGATAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-1393s21c1
Sequence:CCGGGTGATTCATCAATCGAAATACCTCGAGGTATTTCGATTGATGAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201402
VALIDATED
USP17L2 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 17-like family member 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_201402.1-1381s1c1
Sequence:CCGGCCCGACGTACTTGTGATTCATCTCGAGATGAATCACAAGTACGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_201402.1-1341s1c1
Sequence:CCGGGCCTGAGTTCAACGTCAGAAACTCGAGTTTCTGACGTTGAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201402.1-940s1c1
Sequence:CCGGCCTCTTGTCTATGTCCTCTATCTCGAGATAGAGGACATAGACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_201402.1-471s1c1
Sequence:CCGGGCAGGAAGATGCCCATGAATTCTCGAGAATTCATGGGCATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201402.1-1295s1c1
Sequence:CCGGGCACCTTAGACCACTGGAAATCTCGAGATTTCCAGTGGTCTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-568s21c1
Sequence:CCGGACCACCCTCATCCACCAAATACTCGAGTATTTGGTGGATGAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-984s21c1
Sequence:CCGGGAGTTGTCACGACGGACATTACTCGAGTAATGTCCGTCGTGACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-1023s21c1
Sequence:CCGGTCAAGAAGGCCAGTGGTATAACTCGAGTTATACCACTGGCCTTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-144s21c1
Sequence:CCGGTGTCGACCTCTGTGATGATTTCTCGAGAAATCATCACAGAGGTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-787s21c1
Sequence:CCGGGCCTCCAAGACGTTAACTTTACTCGAGTAAAGTTAACGTCTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-851s21c1
Sequence:CCGGCCGATGTCACAGGCAACAAACCTCGAGGTTTGTTGCCTGTGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_201402.2-750s21c1
Sequence:CCGGTGCCTATCATTGCGGTCTTTGCTCGAGCAAAGACCGCAATGATAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-1393s21c1
Sequence:CCGGGTGATTCATCAATCGAAATACCTCGAGGTATTTCGATTGATGAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201402
VALIDATED
USP17L2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 17-like family member 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_201402.1-1381s1c1
Sequence:CCGGCCCGACGTACTTGTGATTCATCTCGAGATGAATCACAAGTACGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_201402.1-1341s1c1
Sequence:CCGGGCCTGAGTTCAACGTCAGAAACTCGAGTTTCTGACGTTGAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201402.1-940s1c1
Sequence:CCGGCCTCTTGTCTATGTCCTCTATCTCGAGATAGAGGACATAGACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_201402.1-471s1c1
Sequence:CCGGGCAGGAAGATGCCCATGAATTCTCGAGAATTCATGGGCATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201402.1-1295s1c1
Sequence:CCGGGCACCTTAGACCACTGGAAATCTCGAGATTTCCAGTGGTCTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-568s21c1
Sequence:CCGGACCACCCTCATCCACCAAATACTCGAGTATTTGGTGGATGAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-984s21c1
Sequence:CCGGGAGTTGTCACGACGGACATTACTCGAGTAATGTCCGTCGTGACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-1023s21c1
Sequence:CCGGTCAAGAAGGCCAGTGGTATAACTCGAGTTATACCACTGGCCTTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-144s21c1
Sequence:CCGGTGTCGACCTCTGTGATGATTTCTCGAGAAATCATCACAGAGGTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-787s21c1
Sequence:CCGGGCCTCCAAGACGTTAACTTTACTCGAGTAAAGTTAACGTCTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-851s21c1
Sequence:CCGGCCGATGTCACAGGCAACAAACCTCGAGGTTTGTTGCCTGTGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_201402.2-750s21c1
Sequence:CCGGTGCCTATCATTGCGGTCTTTGCTCGAGCAAAGACCGCAATGATAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201402.2-1393s21c1
Sequence:CCGGGTGATTCATCAATCGAAATACCTCGAGGTATTTCGATTGATGAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks