EMAIL THIS PAGE TO A FRIEND

USP17L6P

ubiquitin specific peptidase 17-like family member 6, pseudogene

Synonyms: DUB4 USP17L6 vDUB4
Species: Human USP17L6P(391622)
Gene ID:
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_212553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_212553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_212553 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017907 Rosetta Predictions human pricing
XR_039891 Rosetta Predictions human pricing
XR_039892 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494866 predicted 750
2 SASI_Hs02_00494867 predicted 853
3 SASI_Hs02_00494868 predicted 854
4 SASI_Hs02_00494869 predicted 855
5 SASI_Hs02_00494870 predicted 333
6 SASI_Hs02_00494871 predicted 856
7 SASI_Hs02_00494872 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513979 predicted 654
2 SASI_Hs02_00513980 predicted 766
3 SASI_Hs02_00513981 predicted 768
4 SASI_Hs02_00513982 predicted 773
5 SASI_Hs02_00513983 predicted 251
6 SASI_Hs02_00513984 predicted 768
7 SASI_Hs02_00513985 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513986 predicted 747
2 SASI_Hs02_00513987 predicted 850
3 SASI_Hs02_00513988 predicted 863
4 SASI_Hs02_00513989 predicted 855
5 SASI_Hs02_00513990 predicted 333
6 SASI_Hs02_00513991 predicted 854
7 SASI_Hs02_00513992 predicted 331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212553
USP17L6P MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 17-like family member 6, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-630s1c1
Sequence:CCGGCCACGGCATTTCAGACACTTTCTCGAGAAAGTGTCTGAAATGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-579s1c1
Sequence:CCGGCCACCAAATATTTGGAGGCTACTCGAGTAGCCTCCAAATATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-993s1c1
Sequence:CCGGCAACGGACATTACTTCTCTTACTCGAGTAAGAGAAGTAATGTCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-31s1c1
Sequence:CCGGGAGTGGCAGTTCAACCACTTTCTCGAGAAAGTGGTTGAACTGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-729s1c1
Sequence:CCGGCGAAGAACTCAATGGAGAGAACTCGAGTTCTCTCCATTGAGTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212553
USP17L6P MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 17-like family member 6, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-630s1c1
Sequence:CCGGCCACGGCATTTCAGACACTTTCTCGAGAAAGTGTCTGAAATGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-579s1c1
Sequence:CCGGCCACCAAATATTTGGAGGCTACTCGAGTAGCCTCCAAATATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-993s1c1
Sequence:CCGGCAACGGACATTACTTCTCTTACTCGAGTAAGAGAAGTAATGTCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-31s1c1
Sequence:CCGGGAGTGGCAGTTCAACCACTTTCTCGAGAAAGTGGTTGAACTGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-729s1c1
Sequence:CCGGCGAAGAACTCAATGGAGAGAACTCGAGTTCTCTCCATTGAGTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212553
USP17L6P MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 17-like family member 6, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-630s1c1
Sequence:CCGGCCACGGCATTTCAGACACTTTCTCGAGAAAGTGTCTGAAATGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-579s1c1
Sequence:CCGGCCACCAAATATTTGGAGGCTACTCGAGTAGCCTCCAAATATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-993s1c1
Sequence:CCGGCAACGGACATTACTTCTCTTACTCGAGTAAGAGAAGTAATGTCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-31s1c1
Sequence:CCGGGAGTGGCAGTTCAACCACTTTCTCGAGAAAGTGGTTGAACTGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212553.1-729s1c1
Sequence:CCGGCGAAGAACTCAATGGAGAGAACTCGAGTTCTCTCCATTGAGTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks