EMAIL THIS PAGE TO A FRIEND

USP17L9P

ubiquitin specific peptidase 17-like family member 9, pseudogene

Synonyms: RS447 USP17 USP17A USP17H USP17I USP17J USP17K USP17L USP17M
Species: Human USP17L9P(391627)
Gene ID:
9 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001105662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105662 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105662 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324631 predicted 1305
2 SASI_Hs02_00324632 predicted 1304
3 SASI_Hs02_00324633 predicted 858
4 SASI_Hs02_00324634 predicted 854
5 SASI_Hs02_00324635 predicted 336
6 SASI_Hs02_00324636 predicted 339
7 SASI_Hs02_00324637 predicted 1478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105662
USP17L9P MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 17-like family member 9, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-1024s21c1
Sequence:CCGGCAAGAAGGCCAGTGGTATAAACTCGAGTTTATACCACTGGCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-144s21c1
Sequence:CCGGTGTCGACCTCTGTGACGATTTCTCGAGAAATCGTCACAGAGGTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-985s21c1
Sequence:CCGGAGTTGTCACAACGGACATTACCTCGAGGTAATGTCCGTTGTGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-594s21c1
Sequence:CCGGAGGCTACTGGAGATCTCAAATCTCGAGATTTGAGATCTCCAGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-569s21c1
Sequence:CCGGCCACCCTCATCCACCAAATATCTCGAGATATTTGGTGGATGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105662
USP17L9P MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 17-like family member 9, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-1024s21c1
Sequence:CCGGCAAGAAGGCCAGTGGTATAAACTCGAGTTTATACCACTGGCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-144s21c1
Sequence:CCGGTGTCGACCTCTGTGACGATTTCTCGAGAAATCGTCACAGAGGTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-985s21c1
Sequence:CCGGAGTTGTCACAACGGACATTACCTCGAGGTAATGTCCGTTGTGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-594s21c1
Sequence:CCGGAGGCTACTGGAGATCTCAAATCTCGAGATTTGAGATCTCCAGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-569s21c1
Sequence:CCGGCCACCCTCATCCACCAAATATCTCGAGATATTTGGTGGATGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105662
USP17L9P MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 17-like family member 9, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-1024s21c1
Sequence:CCGGCAAGAAGGCCAGTGGTATAAACTCGAGTTTATACCACTGGCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-144s21c1
Sequence:CCGGTGTCGACCTCTGTGACGATTTCTCGAGAAATCGTCACAGAGGTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-985s21c1
Sequence:CCGGAGTTGTCACAACGGACATTACCTCGAGGTAATGTCCGTTGTGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-594s21c1
Sequence:CCGGAGGCTACTGGAGATCTCAAATCTCGAGATTTGAGATCTCCAGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105662.1-569s21c1
Sequence:CCGGCCACCCTCATCCACCAAATATCTCGAGATATTTGGTGGATGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks