EMAIL THIS PAGE TO A FRIEND

USP18

ubiquitin specific peptidase 18

Synonyms: ISG43 UBP43
UniProtKB ID: Q9UMW8, Q6IAD9, Q9NY71
Gene ID:
Human(11274) Summary: The protein encoded by this gene belongs to the ubiquitin-specific proteases (UBP) family of enzymes that cleave ubiquitin from ubiquitinated protein substrates. It is highly expressed in liver and thymus, and is localized to the nucleus. This protein efficiently cleaves only ISG15 (a ubiquitin-like protein) fusions, and deletion of this gene in mice results in a massive increase of ISG15 conjugates in tissues, indicating that this protein is a major ISG15-specific protease. Mice lacking this gene are also hypersensitive to interferon, suggesting a function of this protein in downregulating interferon responses, independent of its isopeptidase activity towards ISG15. [provided by RefSeq, Sep 2011]
Mouse(24110) ubiquitin specific peptidase 18
Rat(312688) ubiquitin specific peptidase 18
cow(515202) ubiquitin specific peptidase 18
domestic guinea pig(100729301) ubiquitin specific peptidase 18
naked mole-rat(101708130) ubiquitin specific peptidase 18
chicken(418167) ubiquitin specific peptidase 18
dog(486763) ubiquitin specific peptidase 18
Horse(100054488) ubiquitin specific peptidase 18
domestic cat(101093867) ubiquitin specific peptidase 18
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017414 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017414 Rosetta Predictions human pricing
NM_001014058 Rosetta Predictions rat pricing
NM_011909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221412 predicted 1334
2 SASI_Hs01_00221413 predicted 1284
3 SASI_Hs01_00221415 predicted 560
4 SASI_Hs01_00221416 predicted 1095
5 SASI_Hs01_00221417 predicted 1053
6 SASI_Hs01_00221419 predicted 1381
7 SASI_Hs01_00221420 predicted 1031
8 SASI_Hs02_00349976 predicted 1279
9 SASI_Hs01_00221421 predicted 1190
10 SASI_Hs02_00349977 predicted 534
11 SASI_Hs01_00221414 predicted 1126
12 SASI_Hs01_00221418 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051248 predicted 264
2 SASI_Rn02_00201452 predicted 807
3 SASI_Rn01_00051249 predicted 295
4 SASI_Rn01_00051250 predicted 1169
5 SASI_Rn01_00051251 predicted 976
6 SASI_Rn02_00201453 predicted 806
7 SASI_Rn01_00051252 predicted 1298
8 SASI_Rn01_00051253 predicted 1296
9 SASI_Rn01_00051254 predicted 871
10 SASI_Rn01_00051255 predicted 1067
11 SASI_Rn01_00051256 predicted 280
12 SASI_Rn01_00051257 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081549 predicted 780
2 SASI_Mm01_00081550 predicted 458
3 SASI_Mm01_00081551 predicted 1456
4 SASI_Mm01_00081552 predicted 1232
5 SASI_Mm01_00081553 predicted 906
6 SASI_Mm01_00081555 predicted 1010
7 SASI_Mm01_00081556 predicted 1248
8 SASI_Mm01_00081557 predicted 1051
9 SASI_Mm01_00081558 predicted 648
10 SASI_Mm02_00321732 predicted 1309
11 SASI_Mm01_00081554 predicted 922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011909
VALIDATED
USP18 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 18
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011909.1-1394s1c1
Sequence:CCGGGCTGCATTTCAACGAGAATAACTCGAGTTATTCTCGTTGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011909.1-423s1c1
Sequence:CCGGGCTTCAAGTGTTCATGATGAACTCGAGTTCATCATGAACACTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011909.1-934s1c1
Sequence:CCGGCAGGTTCTGAAGCTGACTCATCTCGAGATGAGTCAGCTTCAGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011909.1-1149s1c1
Sequence:CCGGGATGGCTGACTTTGGTCATTACTCGAGTAATGACCAAAGTCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011909.1-613s1c1
Sequence:CCGGCCGTTGTTTGTCCAGCACGATCTCGAGATCGTGCTGGACAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011909.2-1188s21c1
Sequence:CCGGGATGGCTGACTTTGGTCATTACTCGAGTAATGACCAAAGTCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011909.2-462s21c1
Sequence:CCGGGCTTCAAGTGTTCATGATGAACTCGAGTTCATCATGAACACTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011909.2-973s21c1
Sequence:CCGGCAGGTTCTGAAGCTGACTCATCTCGAGATGAGTCAGCTTCAGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011909.2-652s21c1
Sequence:CCGGCCGTTGTTTGTCCAGCACGATCTCGAGATCGTGCTGGACAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011909.2-1433s21c1
Sequence:CCGGGCTGCATTTCAACGAGAATAACTCGAGTTATTCTCGTTGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011909
VALIDATED
USP18 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 18
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011909.1-1394s1c1
Sequence:CCGGGCTGCATTTCAACGAGAATAACTCGAGTTATTCTCGTTGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011909.1-423s1c1
Sequence:CCGGGCTTCAAGTGTTCATGATGAACTCGAGTTCATCATGAACACTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011909.1-934s1c1
Sequence:CCGGCAGGTTCTGAAGCTGACTCATCTCGAGATGAGTCAGCTTCAGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011909.1-1149s1c1
Sequence:CCGGGATGGCTGACTTTGGTCATTACTCGAGTAATGACCAAAGTCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011909.1-613s1c1
Sequence:CCGGCCGTTGTTTGTCCAGCACGATCTCGAGATCGTGCTGGACAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011909.2-1188s21c1
Sequence:CCGGGATGGCTGACTTTGGTCATTACTCGAGTAATGACCAAAGTCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011909.2-462s21c1
Sequence:CCGGGCTTCAAGTGTTCATGATGAACTCGAGTTCATCATGAACACTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011909.2-973s21c1
Sequence:CCGGCAGGTTCTGAAGCTGACTCATCTCGAGATGAGTCAGCTTCAGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011909.2-652s21c1
Sequence:CCGGCCGTTGTTTGTCCAGCACGATCTCGAGATCGTGCTGGACAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011909.2-1433s21c1
Sequence:CCGGGCTGCATTTCAACGAGAATAACTCGAGTTATTCTCGTTGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011909
VALIDATED
USP18 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 18
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011909.1-1394s1c1
Sequence:CCGGGCTGCATTTCAACGAGAATAACTCGAGTTATTCTCGTTGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011909.1-423s1c1
Sequence:CCGGGCTTCAAGTGTTCATGATGAACTCGAGTTCATCATGAACACTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011909.1-934s1c1
Sequence:CCGGCAGGTTCTGAAGCTGACTCATCTCGAGATGAGTCAGCTTCAGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011909.1-1149s1c1
Sequence:CCGGGATGGCTGACTTTGGTCATTACTCGAGTAATGACCAAAGTCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011909.1-613s1c1
Sequence:CCGGCCGTTGTTTGTCCAGCACGATCTCGAGATCGTGCTGGACAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011909.2-1188s21c1
Sequence:CCGGGATGGCTGACTTTGGTCATTACTCGAGTAATGACCAAAGTCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011909.2-462s21c1
Sequence:CCGGGCTTCAAGTGTTCATGATGAACTCGAGTTCATCATGAACACTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011909.2-973s21c1
Sequence:CCGGCAGGTTCTGAAGCTGACTCATCTCGAGATGAGTCAGCTTCAGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011909.2-652s21c1
Sequence:CCGGCCGTTGTTTGTCCAGCACGATCTCGAGATCGTGCTGGACAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011909.2-1433s21c1
Sequence:CCGGGCTGCATTTCAACGAGAATAACTCGAGTTATTCTCGTTGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017414
USP18 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017414.x-1419s1c1
Sequence:CCGGACTGCATATCTTCTGGTTTACCTCGAGGTAAACCAGAAGATATGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017414.x-489s1c1
Sequence:CCGGCCTCATGGCCTGGTTGGTTTACTCGAGTAAACCAACCAGGCCATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017414.x-437s1c1
Sequence:CCGGCAGCAACATGAAGAGAGAGCACTCGAGTGCTCTCTCTTCATGTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017414.x-432s1c1
Sequence:CCGGGAAGACAGCAACATGAAGAGACTCGAGTCTCTTCATGTTGCTGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017414.3-542s21c1
Sequence:GTACCGGCTTGATTCAGGTGTTCGTAATCTCGAGATTACGAACACCTGAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017414.3-1854s21c1
Sequence:CCGGACTTGTATACTGGCTGAATATCTCGAGATATTCAGCCAGTATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017414.3-1407s21c1
Sequence:CCGGCACTGGCAGGAAACTGCATATCTCGAGATATGCAGTTTCCTGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017414.3-1275s21c1
Sequence:CCGGATGGCAGACTCCGGTCATTACCTCGAGGTAATGACCGGAGTCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017414.3-489s21c1
Sequence:CCGGCCTCATGGCCTGGTTGGTTTACTCGAGTAAACCAACCAGGCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017414
USP18 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017414.x-1419s1c1
Sequence:CCGGACTGCATATCTTCTGGTTTACCTCGAGGTAAACCAGAAGATATGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017414.x-489s1c1
Sequence:CCGGCCTCATGGCCTGGTTGGTTTACTCGAGTAAACCAACCAGGCCATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017414.x-437s1c1
Sequence:CCGGCAGCAACATGAAGAGAGAGCACTCGAGTGCTCTCTCTTCATGTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017414.x-432s1c1
Sequence:CCGGGAAGACAGCAACATGAAGAGACTCGAGTCTCTTCATGTTGCTGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017414.3-542s21c1
Sequence:GTACCGGCTTGATTCAGGTGTTCGTAATCTCGAGATTACGAACACCTGAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017414.3-1854s21c1
Sequence:CCGGACTTGTATACTGGCTGAATATCTCGAGATATTCAGCCAGTATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017414.3-1407s21c1
Sequence:CCGGCACTGGCAGGAAACTGCATATCTCGAGATATGCAGTTTCCTGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017414.3-1275s21c1
Sequence:CCGGATGGCAGACTCCGGTCATTACCTCGAGGTAATGACCGGAGTCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017414.3-489s21c1
Sequence:CCGGCCTCATGGCCTGGTTGGTTTACTCGAGTAAACCAACCAGGCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017414
USP18 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017414.x-1419s1c1
Sequence:CCGGACTGCATATCTTCTGGTTTACCTCGAGGTAAACCAGAAGATATGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017414.x-489s1c1
Sequence:CCGGCCTCATGGCCTGGTTGGTTTACTCGAGTAAACCAACCAGGCCATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017414.x-437s1c1
Sequence:CCGGCAGCAACATGAAGAGAGAGCACTCGAGTGCTCTCTCTTCATGTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017414.x-432s1c1
Sequence:CCGGGAAGACAGCAACATGAAGAGACTCGAGTCTCTTCATGTTGCTGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017414.3-542s21c1
Sequence:GTACCGGCTTGATTCAGGTGTTCGTAATCTCGAGATTACGAACACCTGAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017414.3-1854s21c1
Sequence:CCGGACTTGTATACTGGCTGAATATCTCGAGATATTCAGCCAGTATACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017414.3-1407s21c1
Sequence:CCGGCACTGGCAGGAAACTGCATATCTCGAGATATGCAGTTTCCTGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017414.3-1275s21c1
Sequence:CCGGATGGCAGACTCCGGTCATTACCTCGAGGTAATGACCGGAGTCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017414.3-489s21c1
Sequence:CCGGCCTCATGGCCTGGTTGGTTTACTCGAGTAAACCAACCAGGCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks