EMAIL THIS PAGE TO A FRIEND

USP19

ubiquitin specific peptidase 19

Synonyms: ZMYND9
Gene ID:
Mouse(71472) ubiquitin specific peptidase 19
Rat(361190) ubiquitin specific peptidase 19
Zebrafish(324335) ubiquitin specific peptidase 19
chicken(100858727) ubiquitin specific peptidase 19
dog(476627) ubiquitin specific peptidase 19
Horse(100053587) ubiquitin specific peptidase 19
domestic cat(101081789) ubiquitin specific peptidase 19
naked mole-rat(101703047) ubiquitin specific peptidase 19
Domestic Rabbit(100357584) ubiquitin specific peptidase 19
domestic guinea pig(100731773) ubiquitin specific peptidase 19
cow(514587) ubiquitin specific peptidase 19
sheep(101117972) ubiquitin specific peptidase 19
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006677 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_496642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496642 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006677 Rosetta Predictions human pricing
NM_001001516 Rosetta Predictions rat pricing
XM_573962 Rosetta Predictions rat pricing
NM_027804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130241 predicted 2054
2 SASI_Hs01_00130242 predicted 3562
3 SASI_Hs01_00130243 predicted 3733
4 SASI_Hs01_00130244 predicted 3507
5 SASI_Hs01_00130245 predicted 3246
6 SASI_Hs01_00130246 predicted 1855
7 SASI_Hs01_00130247 predicted 2074
8 SASI_Hs01_00130248 predicted 3623
9 SASI_Hs01_00130249 predicted 2353
10 SASI_Hs01_00130250 predicted 2414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072193 predicted 1808
2 SASI_Rn01_00072195 predicted 3691
3 SASI_Rn01_00072196 predicted 378
4 SASI_Rn01_00072197 predicted 1510
5 SASI_Rn01_00072198 predicted 2316
6 SASI_Rn01_00072199 predicted 3518
7 SASI_Rn01_00072200 predicted 2016
8 SASI_Rn01_00072201 predicted 3407
9 SASI_Rn01_00072202 predicted 3552
10 SASI_Rn02_00197918 predicted 3591
11 SASI_Rn01_00072194 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00191009 predicted 1952
2 SASI_Rn01_00191010 predicted 1017
3 SASI_Rn01_00191011 predicted 1656
4 SASI_Rn01_00191012 predicted 1798
5 SASI_Rn01_00191013 predicted 3666
6 SASI_Rn01_00191014 predicted 1853
7 SASI_Rn01_00191015 predicted 2164
8 SASI_Rn01_00191016 predicted 3557
9 SASI_Rn01_00191017 predicted 3662
10 SASI_Rn01_00191018 predicted 3707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116950 predicted 3755
2 SASI_Mm01_00116951 predicted 1801
3 SASI_Mm01_00116952 predicted 1028
4 SASI_Mm01_00116953 predicted 3431
5 SASI_Mm01_00116955 predicted 3500
6 SASI_Mm01_00116956 predicted 3896
7 SASI_Mm01_00116957 predicted 1771
8 SASI_Mm01_00116958 predicted 2705
9 SASI_Mm01_00116959 predicted 3920
10 SASI_Mm02_00332747 predicted 3879
11 SASI_Mm01_00116954 predicted 2097
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006677
VALIDATED
USP19 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 19
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_006677.1-2282s21c1
Sequence:CCGGCTCCACTGCGAGCGAAGTATTCTCGAGAATACTTCGCTCGCAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006677.1-4205s21c1
Sequence:CCGGTTGGGCCTCAGCTTATGCATCCTCGAGGATGCATAAGCTGAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006677.1-4166s21c1
Sequence:CCGGGGCCATGCCTGCCTTTGTTGTCTCGAGACAACAAAGGCAGGCATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006677.1-2753s21c1
Sequence:CCGGCCGGTACTCTGTGAGTGTATTCTCGAGAATACACTCACAGAGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006677.1-3596s21c1
Sequence:CCGGGCTGCCCAGCTACGATCTATACTCGAGTATAGATCGTAGCTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006677.1-2080s21c1
Sequence:CCGGCTTTCATCGTGGACCTATTTCCTCGAGGAAATAGGTCCACGATGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006677
VALIDATED
USP19 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 19
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_006677.1-2282s21c1
Sequence:CCGGCTCCACTGCGAGCGAAGTATTCTCGAGAATACTTCGCTCGCAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006677.1-4205s21c1
Sequence:CCGGTTGGGCCTCAGCTTATGCATCCTCGAGGATGCATAAGCTGAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006677.1-4166s21c1
Sequence:CCGGGGCCATGCCTGCCTTTGTTGTCTCGAGACAACAAAGGCAGGCATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006677.1-2753s21c1
Sequence:CCGGCCGGTACTCTGTGAGTGTATTCTCGAGAATACACTCACAGAGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006677.1-3596s21c1
Sequence:CCGGGCTGCCCAGCTACGATCTATACTCGAGTATAGATCGTAGCTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006677.1-2080s21c1
Sequence:CCGGCTTTCATCGTGGACCTATTTCCTCGAGGAAATAGGTCCACGATGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006677
VALIDATED
USP19 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 19
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_006677.1-2282s21c1
Sequence:CCGGCTCCACTGCGAGCGAAGTATTCTCGAGAATACTTCGCTCGCAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006677.1-4205s21c1
Sequence:CCGGTTGGGCCTCAGCTTATGCATCCTCGAGGATGCATAAGCTGAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006677.1-4166s21c1
Sequence:CCGGGGCCATGCCTGCCTTTGTTGTCTCGAGACAACAAAGGCAGGCATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006677.1-2753s21c1
Sequence:CCGGCCGGTACTCTGTGAGTGTATTCTCGAGAATACACTCACAGAGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006677.1-3596s21c1
Sequence:CCGGGCTGCCCAGCTACGATCTATACTCGAGTATAGATCGTAGCTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006677.1-2080s21c1
Sequence:CCGGCTTTCATCGTGGACCTATTTCCTCGAGGAAATAGGTCCACGATGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027804
VALIDATED
USP19 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 19
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027804.2-2307s21c1
Sequence:CCGGCGGCACAAGATGAGAAATGATCTCGAGATCATTTCTCATCTTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027804.2-3985s21c1
Sequence:CCGGCGGTGACAACAGTAGACGAAACTCGAGTTTCGTCTACTGTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027804.2-1992s21c1
Sequence:CCGGCGATCCTTTGAAGCTGAGATTCTCGAGAATCTCAGCTTCAAAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027804.2-2593s21c1
Sequence:CCGGTGCGCCTAGCCGAGGTAATTACTCGAGTAATTACCTCGGCTAGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027804.2-4542s1c1
Sequence:CCGGCAGTTGTCTGTCGTCCTGTTTCTCGAGAAACAGGACGACAGACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027804.2-3985s1c1
Sequence:CCGGCGGTGACAACAGTAGACGAAACTCGAGTTTCGTCTACTGTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027804.2-417s1c1
Sequence:CCGGCCTCGAAAGGAACCAACCAAACTCGAGTTTGGTTGGTTCCTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027804.2-1992s1c1
Sequence:CCGGCGATCCTTTGAAGCTGAGATTCTCGAGAATCTCAGCTTCAAAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027804.2-2307s1c1
Sequence:CCGGCGGCACAAGATGAGAAATGATCTCGAGATCATTTCTCATCTTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027804
VALIDATED
USP19 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 19
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027804.2-2307s21c1
Sequence:CCGGCGGCACAAGATGAGAAATGATCTCGAGATCATTTCTCATCTTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027804.2-3985s21c1
Sequence:CCGGCGGTGACAACAGTAGACGAAACTCGAGTTTCGTCTACTGTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027804.2-1992s21c1
Sequence:CCGGCGATCCTTTGAAGCTGAGATTCTCGAGAATCTCAGCTTCAAAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027804.2-2593s21c1
Sequence:CCGGTGCGCCTAGCCGAGGTAATTACTCGAGTAATTACCTCGGCTAGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027804.2-4542s1c1
Sequence:CCGGCAGTTGTCTGTCGTCCTGTTTCTCGAGAAACAGGACGACAGACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027804.2-3985s1c1
Sequence:CCGGCGGTGACAACAGTAGACGAAACTCGAGTTTCGTCTACTGTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027804.2-417s1c1
Sequence:CCGGCCTCGAAAGGAACCAACCAAACTCGAGTTTGGTTGGTTCCTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027804.2-1992s1c1
Sequence:CCGGCGATCCTTTGAAGCTGAGATTCTCGAGAATCTCAGCTTCAAAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027804.2-2307s1c1
Sequence:CCGGCGGCACAAGATGAGAAATGATCTCGAGATCATTTCTCATCTTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027804
VALIDATED
USP19 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 19
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027804.2-2307s21c1
Sequence:CCGGCGGCACAAGATGAGAAATGATCTCGAGATCATTTCTCATCTTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027804.2-3985s21c1
Sequence:CCGGCGGTGACAACAGTAGACGAAACTCGAGTTTCGTCTACTGTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027804.2-1992s21c1
Sequence:CCGGCGATCCTTTGAAGCTGAGATTCTCGAGAATCTCAGCTTCAAAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027804.2-2593s21c1
Sequence:CCGGTGCGCCTAGCCGAGGTAATTACTCGAGTAATTACCTCGGCTAGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027804.2-4542s1c1
Sequence:CCGGCAGTTGTCTGTCGTCCTGTTTCTCGAGAAACAGGACGACAGACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027804.2-3985s1c1
Sequence:CCGGCGGTGACAACAGTAGACGAAACTCGAGTTTCGTCTACTGTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027804.2-417s1c1
Sequence:CCGGCCTCGAAAGGAACCAACCAAACTCGAGTTTGGTTGGTTCCTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027804.2-1992s1c1
Sequence:CCGGCGATCCTTTGAAGCTGAGATTCTCGAGAATCTCAGCTTCAAAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027804.2-2307s1c1
Sequence:CCGGCGGCACAAGATGAGAAATGATCTCGAGATCATTTCTCATCTTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496642
VALIDATED
USP19 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 19
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:XM_496642.1-4627s1c1
Sequence:CCGGGCGTGATTTGATTCTGTTGTACTCGAGTACAACAGAATCAAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496642.1-1173s1c1
Sequence:CCGGGCTGATGAACAGCTTTGCATACTCGAGTATGCAAAGCTGTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_496642.1-3917s1c1
Sequence:CCGGGCGTGACAAGATCAATGACTTCTCGAGAAGTCATTGATCTTGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:XM_496642.1-2758s1c1
Sequence:CCGGCGGAGGTAATTAAGAATCGTTCTCGAGAACGATTCTTAATTACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496642.1-2265s1c1
Sequence:CCGGCCTTCCAAGTTGAAGGCCATTCTCGAGAATGGCCTTCAACTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496642
VALIDATED
USP19 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 19
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:XM_496642.1-4627s1c1
Sequence:CCGGGCGTGATTTGATTCTGTTGTACTCGAGTACAACAGAATCAAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496642.1-1173s1c1
Sequence:CCGGGCTGATGAACAGCTTTGCATACTCGAGTATGCAAAGCTGTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_496642.1-3917s1c1
Sequence:CCGGGCGTGACAAGATCAATGACTTCTCGAGAAGTCATTGATCTTGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:XM_496642.1-2758s1c1
Sequence:CCGGCGGAGGTAATTAAGAATCGTTCTCGAGAACGATTCTTAATTACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496642.1-2265s1c1
Sequence:CCGGCCTTCCAAGTTGAAGGCCATTCTCGAGAATGGCCTTCAACTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496642
VALIDATED
USP19 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 19
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:XM_496642.1-4627s1c1
Sequence:CCGGGCGTGATTTGATTCTGTTGTACTCGAGTACAACAGAATCAAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496642.1-1173s1c1
Sequence:CCGGGCTGATGAACAGCTTTGCATACTCGAGTATGCAAAGCTGTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_496642.1-3917s1c1
Sequence:CCGGGCGTGACAAGATCAATGACTTCTCGAGAAGTCATTGATCTTGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:XM_496642.1-2758s1c1
Sequence:CCGGCGGAGGTAATTAAGAATCGTTCTCGAGAACGATTCTTAATTACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496642.1-2265s1c1
Sequence:CCGGCCTTCCAAGTTGAAGGCCATTCTCGAGAATGGCCTTCAACTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks