EMAIL THIS PAGE TO A FRIEND

USP1

ubiquitin specific peptidase 1

Synonyms: UBP
Gene ID:
Human(7398) Summary: This gene encodes a member of the ubiquitin-specific processing (UBP) family of proteases that is a deubiquitinating enzyme (DUB) with His and Cys domains. This protein is located in the cytoplasm and cleaves the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. The protein specifically deubiquitinates a protein in the Fanconi anemia (FA) DNA repair pathway. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
Mouse(230484) ubiquitin specific peptidase 1
Rat(313387) ubiquitin specific peptidase 1
cow(516328) ubiquitin specific peptidase 1
sheep(101107236) ubiquitin specific peptidase 1
domestic guinea pig(100722039) ubiquitin specific peptidase 1
Domestic Rabbit(100358366) ubiquitin specific peptidase 1
naked mole-rat(101716794) ubiquitin specific peptidase 1
Zebrafish(322007) ubiquitin specific protease 1
chicken(424685) ubiquitin specific peptidase 1
domestic cat(101080903) ubiquitin specific peptidase 1
Horse(100070397) ubiquitin specific peptidase 1
dog(479549) ubiquitin specific peptidase 1
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003368 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146144 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146144 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146144 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017415 Rosetta Predictions human pricing
NM_001017416 Rosetta Predictions human pricing
NM_003368 Rosetta Predictions human pricing
NM_001015015 Rosetta Predictions rat pricing
NM_146144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204271 predicted 606
2 SASI_Hs01_00204272 predicted 2720
3 SASI_Hs01_00204273 predicted 1974
4 SASI_Hs01_00204274 predicted 567
5 SASI_Hs01_00204275 predicted 1621
6 SASI_Hs01_00204276 predicted 1237
7 SASI_Hs01_00204277 predicted 590
8 SASI_Hs02_00306741 predicted 1044
9 SASI_Hs02_00306742 predicted 683
10 SASI_Hs01_00204278 predicted 1251
11 SASI_Hs01_00204279 predicted 2527
12 SASI_Hs01_00204280 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024390 predicted 510
2 SASI_Hs01_00024391 predicted 2620
3 SASI_Hs01_00024392 predicted 1874
4 SASI_Hs01_00024393 predicted 470
5 SASI_Hs01_00024394 predicted 1526
6 SASI_Hs01_00024395 predicted 1142
7 SASI_Hs01_00024396 predicted 490
8 SASI_Hs02_00306743 predicted 956
9 SASI_Hs02_00306744 predicted 595
10 SASI_Hs01_00024397 predicted 1153
11 SASI_Hs01_00024398 predicted 2436
12 SASI_Hs01_00024399 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157121 predicted 1033
2 SASI_Hs01_00157122 predicted 3149
3 SASI_Hs01_00157123 predicted 2397
4 SASI_Hs01_00157124 predicted 996
5 SASI_Hs01_00157125 predicted 2055
6 SASI_Hs01_00157126 predicted 1666
7 SASI_Hs01_00157127 predicted 1015
8 SASI_Hs02_00335522 predicted 1473
9 SASI_Hs02_00335523 predicted 1118
10 SASI_Hs01_00157128 predicted 1684
11 SASI_Hs01_00157129 predicted 2954
12 SASI_Hs01_00157130 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202013 predicted 1669
2 SASI_Rn02_00202014 predicted 455
3 SASI_Rn02_00202015 predicted 548
4 SASI_Rn02_00202016 predicted 1734
5 SASI_Rn02_00202017 predicted 2893
6 SASI_Rn02_00202018 predicted 1605
7 SASI_Rn02_00202019 predicted 2093
8 SASI_Rn02_00202020 predicted 824
9 SASI_Rn02_00202021 predicted 1802
10 SASI_Rn02_00202022 predicted 2170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188559 predicted 484
2 SASI_Mm01_00188560 predicted 1828
3 SASI_Mm01_00188561 predicted 1639
4 SASI_Mm02_00341832 predicted 2105
5 SASI_Mm01_00188562 predicted 1652
6 SASI_Mm01_00188563 predicted 1928
7 SASI_Mm01_00188564 predicted 2674
8 SASI_Mm01_00188565 predicted 2923
9 SASI_Mm01_00188566 predicted 1560
10 SASI_Mm01_00188567 predicted 1408
11 SASI_Mm01_00188568 predicted 744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003368
USP1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003368.x-707s1c1
Sequence:CCGGGACTGAATAATCTCGGCAATACTCGAGTATTGCCGAGATTATTCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003368.x-1350s1c1
Sequence:CCGGCCAGAGACAAACTAGATCAAACTCGAGTTTGATCTAGTTTGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003368.x-3139s1c1
Sequence:CCGGGCTCGTATTTGTATTCTCCATCTCGAGATGGAGAATACAAATACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003368.x-2615s1c1
Sequence:CCGGCCAGTGACCAAACAGGCATTACTCGAGTAATGCCTGTTTGGTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003368.x-2071s1c1
Sequence:CCGGGCTAGTGGTTTGGAGTTTGATCTCGAGATCAAACTCCAAACCACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003368.4-1003s21c1
Sequence:CCGGGACTGAATAATCTCGGCAATACTCGAGTATTGCCGAGATTATTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003368.4-2367s21c1
Sequence:CCGGGCTAGTGGTTTGGAGTTTGATCTCGAGATCAAACTCCAAACCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003368.4-1646s21c1
Sequence:CCGGCCAGAGACAAACTAGATCAAACTCGAGTTTGATCTAGTTTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003368
USP1 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003368.x-707s1c1
Sequence:CCGGGACTGAATAATCTCGGCAATACTCGAGTATTGCCGAGATTATTCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003368.x-1350s1c1
Sequence:CCGGCCAGAGACAAACTAGATCAAACTCGAGTTTGATCTAGTTTGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003368.x-3139s1c1
Sequence:CCGGGCTCGTATTTGTATTCTCCATCTCGAGATGGAGAATACAAATACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003368.x-2615s1c1
Sequence:CCGGCCAGTGACCAAACAGGCATTACTCGAGTAATGCCTGTTTGGTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003368.x-2071s1c1
Sequence:CCGGGCTAGTGGTTTGGAGTTTGATCTCGAGATCAAACTCCAAACCACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003368.4-1003s21c1
Sequence:CCGGGACTGAATAATCTCGGCAATACTCGAGTATTGCCGAGATTATTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003368.4-2367s21c1
Sequence:CCGGGCTAGTGGTTTGGAGTTTGATCTCGAGATCAAACTCCAAACCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003368.4-1646s21c1
Sequence:CCGGCCAGAGACAAACTAGATCAAACTCGAGTTTGATCTAGTTTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003368
USP1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003368.x-707s1c1
Sequence:CCGGGACTGAATAATCTCGGCAATACTCGAGTATTGCCGAGATTATTCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003368.x-1350s1c1
Sequence:CCGGCCAGAGACAAACTAGATCAAACTCGAGTTTGATCTAGTTTGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003368.x-3139s1c1
Sequence:CCGGGCTCGTATTTGTATTCTCCATCTCGAGATGGAGAATACAAATACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003368.x-2615s1c1
Sequence:CCGGCCAGTGACCAAACAGGCATTACTCGAGTAATGCCTGTTTGGTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003368.x-2071s1c1
Sequence:CCGGGCTAGTGGTTTGGAGTTTGATCTCGAGATCAAACTCCAAACCACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003368.4-1003s21c1
Sequence:CCGGGACTGAATAATCTCGGCAATACTCGAGTATTGCCGAGATTATTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003368.4-2367s21c1
Sequence:CCGGGCTAGTGGTTTGGAGTTTGATCTCGAGATCAAACTCCAAACCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003368.4-1646s21c1
Sequence:CCGGCCAGAGACAAACTAGATCAAACTCGAGTTTGATCTAGTTTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146144
VALIDATED
USP1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146144.2-2636s1c1
Sequence:CCGGCAGTGACCAAACAGGCGTTAACTCGAGTTAACGCCTGTTTGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146144.2-984s1c1
Sequence:CCGGCCAGAGAAATATACAGATGAACTCGAGTTCATCTGTATATTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146144.2-2157s1c1
Sequence:CCGGCCTCTTAAACTGTCACTAGAACTCGAGTTCTAGTGACAGTTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146144.2-2566s1c1
Sequence:CCGGCCGACAATAGAAATTCTGAAACTCGAGTTTCAGAATTTCTATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146144.2-588s1c1
Sequence:CCGGAGAGCCTTAGACTTTACTGATCTCGAGATCAGTAAAGTCTAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146144
VALIDATED
USP1 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146144.2-2636s1c1
Sequence:CCGGCAGTGACCAAACAGGCGTTAACTCGAGTTAACGCCTGTTTGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146144.2-984s1c1
Sequence:CCGGCCAGAGAAATATACAGATGAACTCGAGTTCATCTGTATATTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146144.2-2157s1c1
Sequence:CCGGCCTCTTAAACTGTCACTAGAACTCGAGTTCTAGTGACAGTTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146144.2-2566s1c1
Sequence:CCGGCCGACAATAGAAATTCTGAAACTCGAGTTTCAGAATTTCTATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146144.2-588s1c1
Sequence:CCGGAGAGCCTTAGACTTTACTGATCTCGAGATCAGTAAAGTCTAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146144
VALIDATED
USP1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146144.2-2636s1c1
Sequence:CCGGCAGTGACCAAACAGGCGTTAACTCGAGTTAACGCCTGTTTGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146144.2-984s1c1
Sequence:CCGGCCAGAGAAATATACAGATGAACTCGAGTTCATCTGTATATTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146144.2-2157s1c1
Sequence:CCGGCCTCTTAAACTGTCACTAGAACTCGAGTTCTAGTGACAGTTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146144.2-2566s1c1
Sequence:CCGGCCGACAATAGAAATTCTGAAACTCGAGTTTCAGAATTTCTATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146144.2-588s1c1
Sequence:CCGGAGAGCCTTAGACTTTACTGATCTCGAGATCAGTAAAGTCTAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks