EMAIL THIS PAGE TO A FRIEND

USP20

ubiquitin specific peptidase 20

Synonyms: LSFR3A VDU2 hVDU2
UniProtKB ID: Q9Y2K6, Q541F1, Q8IXQ1, Q96LG5, Q9UQN8, Q9UQP0
Gene ID:
Human(10868) Summary: This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Mouse(74270) ubiquitin specific peptidase 20
Rat(311856) ubiquitin specific peptidase 20
Zebrafish(393962) ubiquitin specific protease 20
Horse(100066778) ubiquitin specific peptidase 20
chicken(417188) ubiquitin specific peptidase 20
dog(480696) ubiquitin specific peptidase 20
domestic cat(101086431) ubiquitin specific peptidase 20
naked mole-rat(101701963) ubiquitin specific peptidase 20
domestic guinea pig(100729086) ubiquitin specific peptidase 20
cow(505839) ubiquitin specific peptidase 20
sheep(101102635) ubiquitin specific peptidase 20
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006676 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028846 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028846 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028846 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008563 Rosetta Predictions human pricing
NM_001110303 Rosetta Predictions human pricing
NM_006676 Rosetta Predictions human pricing
NM_001107827 Rosetta Predictions rat pricing
NM_028846 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033438 predicted 1661
2 SASI_Hs01_00033439 predicted 2364
3 SASI_Hs01_00033440 predicted 1889
4 SASI_Hs01_00033441 predicted 2686
5 SASI_Hs02_00305501 predicted 489
6 SASI_Hs01_00033442 predicted 682
7 SASI_Hs02_00305502 predicted 423
8 SASI_Hs02_00305503 predicted 1597
9 SASI_Hs02_00305504 predicted 1584
10 SASI_Hs01_00033444 predicted 2785
11 SASI_Hs01_00033436 predicted 600
12 SASI_Hs01_00033437 predicted 434
13 SASI_Hs01_00033443 predicted 1216
14 SASI_Hs01_00033445 predicted 1599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324905 predicted 1623
2 SASI_Hs02_00324906 predicted 2329
3 SASI_Hs02_00324907 predicted 1859
4 SASI_Hs02_00324908 predicted 2654
5 SASI_Hs02_00324909 predicted 452
6 SASI_Hs02_00324910 predicted 638
7 SASI_Hs02_00324911 predicted 384
8 SASI_Hs02_00324912 predicted 1559
9 SASI_Hs02_00324913 predicted 1550
10 SASI_Hs02_00324914 predicted 2744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099343 predicted 1626
2 SASI_Hs01_00099344 predicted 2328
3 SASI_Hs01_00099345 predicted 1861
4 SASI_Hs01_00099346 predicted 2649
5 SASI_Hs02_00342078 predicted 449
6 SASI_Hs01_00099347 predicted 638
7 SASI_Hs02_00342079 predicted 384
8 SASI_Hs02_00342080 predicted 1557
9 SASI_Hs02_00342081 predicted 1548
10 SASI_Hs01_00099349 predicted 2748
11 SASI_Hs01_00099341 predicted 516
12 SASI_Hs01_00099342 predicted 342
13 SASI_Hs01_00099348 predicted 1120
14 SASI_Hs01_00099350 predicted 1505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232665 predicted 2829
2 SASI_Rn02_00232666 predicted 1620
3 SASI_Rn02_00232667 predicted 2056
4 SASI_Rn02_00232668 predicted 526
5 SASI_Rn02_00232669 predicted 950
6 SASI_Rn02_00232670 predicted 359
7 SASI_Rn02_00232671 predicted 1152
8 SASI_Rn02_00232672 predicted 2323
9 SASI_Rn02_00232673 predicted 2394
10 SASI_Rn02_00232674 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152294 predicted 2771
2 SASI_Mm01_00152295 predicted 487
3 SASI_Mm01_00152296 predicted 1849
4 SASI_Mm02_00334492 predicted 1383
5 SASI_Mm01_00152297 predicted 1092
6 SASI_Mm02_00334493 predicted 1183
7 SASI_Mm01_00152298 predicted 1832
8 SASI_Mm01_00152299 predicted 336
9 SASI_Mm01_00152300 predicted 2812
10 SASI_Mm01_00152302 predicted 1811
11 SASI_Mm01_00152301 predicted 1465
12 SASI_Mm01_00152303 predicted 2268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006676
VALIDATED
USP20 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 20
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006676.6-358s21c1
Sequence:CCGGCTATGTTGGCTGCGGAGAATCCTCGAGGATTCTCCGCAGCCAACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006676.6-2605s21c1
Sequence:CCGGCGACACCTTCATCAAGTTGAACTCGAGTTCAACTTGATGAAGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006676.6-4135s21c1
Sequence:CCGGGCGACCATCATCAGGATCAAACTCGAGTTTGATCCTGATGATGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006676.6-2169s21c1
Sequence:CCGGATGGGCAGTGGTACGAGTTTGCTCGAGCAAACTCGTACCACTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006676.6-1951s21c1
Sequence:CCGGGATCCTGTGCATTCACCTAAACTCGAGTTTAGGTGAATGCACAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006676.2-4079s1c1
Sequence:CCGGGCGACCATCATCAGGATCAAACTCGAGTTTGATCCTGATGATGGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006676.2-410s1c1
Sequence:CCGGCGCCTGTGAGAAGGAGGTATTCTCGAGAATACCTCCTTCTCACAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006676.2-2679s1c1
Sequence:CCGGCCCATTGACAACAGCAGGATTCTCGAGAATCCTGCTGTTGTCAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006676.2-2549s1c1
Sequence:CCGGCGACACCTTCATCAAGTTGAACTCGAGTTCAACTTGATGAAGGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006676.2-1494s1c1
Sequence:CCGGGACATCTTTGACGGCTCCATTCTCGAGAATGGAGCCGTCAAAGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006676
VALIDATED
USP20 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 20
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006676.6-358s21c1
Sequence:CCGGCTATGTTGGCTGCGGAGAATCCTCGAGGATTCTCCGCAGCCAACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006676.6-2605s21c1
Sequence:CCGGCGACACCTTCATCAAGTTGAACTCGAGTTCAACTTGATGAAGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006676.6-4135s21c1
Sequence:CCGGGCGACCATCATCAGGATCAAACTCGAGTTTGATCCTGATGATGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006676.6-2169s21c1
Sequence:CCGGATGGGCAGTGGTACGAGTTTGCTCGAGCAAACTCGTACCACTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006676.6-1951s21c1
Sequence:CCGGGATCCTGTGCATTCACCTAAACTCGAGTTTAGGTGAATGCACAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006676.2-4079s1c1
Sequence:CCGGGCGACCATCATCAGGATCAAACTCGAGTTTGATCCTGATGATGGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006676.2-410s1c1
Sequence:CCGGCGCCTGTGAGAAGGAGGTATTCTCGAGAATACCTCCTTCTCACAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006676.2-2679s1c1
Sequence:CCGGCCCATTGACAACAGCAGGATTCTCGAGAATCCTGCTGTTGTCAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006676.2-2549s1c1
Sequence:CCGGCGACACCTTCATCAAGTTGAACTCGAGTTCAACTTGATGAAGGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006676.2-1494s1c1
Sequence:CCGGGACATCTTTGACGGCTCCATTCTCGAGAATGGAGCCGTCAAAGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006676
VALIDATED
USP20 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 20
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006676.6-358s21c1
Sequence:CCGGCTATGTTGGCTGCGGAGAATCCTCGAGGATTCTCCGCAGCCAACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006676.6-2605s21c1
Sequence:CCGGCGACACCTTCATCAAGTTGAACTCGAGTTCAACTTGATGAAGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006676.6-4135s21c1
Sequence:CCGGGCGACCATCATCAGGATCAAACTCGAGTTTGATCCTGATGATGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006676.6-2169s21c1
Sequence:CCGGATGGGCAGTGGTACGAGTTTGCTCGAGCAAACTCGTACCACTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006676.6-1951s21c1
Sequence:CCGGGATCCTGTGCATTCACCTAAACTCGAGTTTAGGTGAATGCACAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006676.2-4079s1c1
Sequence:CCGGGCGACCATCATCAGGATCAAACTCGAGTTTGATCCTGATGATGGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006676.2-410s1c1
Sequence:CCGGCGCCTGTGAGAAGGAGGTATTCTCGAGAATACCTCCTTCTCACAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006676.2-2679s1c1
Sequence:CCGGCCCATTGACAACAGCAGGATTCTCGAGAATCCTGCTGTTGTCAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006676.2-2549s1c1
Sequence:CCGGCGACACCTTCATCAAGTTGAACTCGAGTTCAACTTGATGAAGGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006676.2-1494s1c1
Sequence:CCGGGACATCTTTGACGGCTCCATTCTCGAGAATGGAGCCGTCAAAGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028846
VALIDATED
USP20 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028846.1-1439s1c1
Sequence:CCGGCCGTCGTATGTGCTCAAGAAACTCGAGTTTCTTGAGCACATACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028846.1-2407s1c1
Sequence:CCGGCCCACCCAACAAATACCACTACTCGAGTAGTGGTATTTGTTGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028846.1-1868s1c1
Sequence:CCGGCGGTGTAAGAAGCTTCGGAATCTCGAGATTCCGAAGCTTCTTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028846.1-2322s1c1
Sequence:CCGGCCCGAGAATGGCTCAACAAATCTCGAGATTTGTTGAGCCATTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028846.1-545s1c1
Sequence:CCGGCCTATTGCTGTGGCTGATGAACTCGAGTTCATCAGCCACAGCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028846
VALIDATED
USP20 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028846.1-1439s1c1
Sequence:CCGGCCGTCGTATGTGCTCAAGAAACTCGAGTTTCTTGAGCACATACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028846.1-2407s1c1
Sequence:CCGGCCCACCCAACAAATACCACTACTCGAGTAGTGGTATTTGTTGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028846.1-1868s1c1
Sequence:CCGGCGGTGTAAGAAGCTTCGGAATCTCGAGATTCCGAAGCTTCTTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028846.1-2322s1c1
Sequence:CCGGCCCGAGAATGGCTCAACAAATCTCGAGATTTGTTGAGCCATTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028846.1-545s1c1
Sequence:CCGGCCTATTGCTGTGGCTGATGAACTCGAGTTCATCAGCCACAGCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028846
VALIDATED
USP20 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028846.1-1439s1c1
Sequence:CCGGCCGTCGTATGTGCTCAAGAAACTCGAGTTTCTTGAGCACATACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028846.1-2407s1c1
Sequence:CCGGCCCACCCAACAAATACCACTACTCGAGTAGTGGTATTTGTTGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028846.1-1868s1c1
Sequence:CCGGCGGTGTAAGAAGCTTCGGAATCTCGAGATTCCGAAGCTTCTTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028846.1-2322s1c1
Sequence:CCGGCCCGAGAATGGCTCAACAAATCTCGAGATTTGTTGAGCCATTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028846.1-545s1c1
Sequence:CCGGCCTATTGCTGTGGCTGATGAACTCGAGTTCATCAGCCACAGCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks