EMAIL THIS PAGE TO A FRIEND

USP21

ubiquitin specific peptidase 21

Synonyms: USP16 USP23
Gene ID:
Human(27005) Summary: This gene encodes a member of the C19 peptidase family, also known as family 2 of ubiquitin carboxy-terminal hydrolases. The encoded protein cleaves ubiquitin from ubiquitinated proteins for recycling in intracellular protein degradation. The encoded protein is also able to release NEDD8, a ubiquitin-like protein, from NEDD8-conjugated proteins. This gene has been referred to as USP16 and USP23 but is now known as USP21. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
Mouse(30941) ubiquitin specific peptidase 21
Rat(688466) ubiquitin specific peptidase 21
cow(534273) ubiquitin specific peptidase 21
sheep(101103025) ubiquitin specific peptidase 21
domestic guinea pig(100735355) ubiquitin specific peptidase 21
naked mole-rat(101704618) ubiquitin specific peptidase 21
Domestic Rabbit(100339324) ubiquitin specific peptidase 21
dog(478979) ubiquitin specific peptidase 21
Horse(100066197) ubiquitin specific peptidase 21
domestic cat(101090585) ubiquitin specific peptidase 21
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012475 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014443 Rosetta Predictions human pricing
NM_012475 Rosetta Predictions human pricing
NM_001127638 Rosetta Predictions rat pricing
NM_013919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193567 predicted 690
2 SASI_Hs01_00193568 predicted 960
3 SASI_Hs01_00193569 predicted 1403
4 SASI_Hs01_00193570 predicted 815
5 SASI_Hs01_00193571 predicted 1001
6 SASI_Hs01_00193572 predicted 1472
7 SASI_Hs01_00193573 predicted 1734
8 SASI_Hs02_00306548 predicted 1025
9 SASI_Hs01_00193574 predicted 1206
10 SASI_Hs01_00193575 predicted 1493
11 SASI_Hs01_00193576 predicted 1428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177787 predicted 548
2 SASI_Hs01_00177788 predicted 820
3 SASI_Hs01_00177789 predicted 1260
4 SASI_Hs01_00177790 predicted 682
5 SASI_Hs01_00177791 predicted 863
6 SASI_Hs01_00177792 predicted 1330
7 SASI_Hs01_00177793 predicted 1595
8 SASI_Hs02_00344387 predicted 887
9 SASI_Hs01_00177794 predicted 1060
10 SASI_Hs01_00177795 predicted 1346
11 SASI_Hs01_00177796 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254710 predicted 646
2 SASI_Rn02_00254711 predicted 786
3 SASI_Rn02_00254712 predicted 875
4 SASI_Rn02_00254713 predicted 830
5 SASI_Rn02_00254714 predicted 1301
6 SASI_Rn02_00254715 predicted 1429
7 SASI_Rn02_00254716 predicted 854
8 SASI_Rn02_00254717 predicted 1031
9 SASI_Rn02_00254718 predicted 1318
10 SASI_Rn02_00254719 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146752 predicted 501
2 SASI_Mm01_00146753 predicted 627
3 SASI_Mm01_00146754 predicted 777
4 SASI_Mm01_00146755 predicted 809
5 SASI_Mm01_00146756 predicted 1237
6 SASI_Mm01_00146757 predicted 1287
7 SASI_Mm01_00146758 predicted 1008
8 SASI_Mm01_00146759 predicted 1424
9 SASI_Mm01_00146760 predicted 1297
10 SASI_Mm01_00146761 predicted 964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012475
VALIDATED
USP21 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 21
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012475.x-1057s1c1
Sequence:CCGGGCTCCACCGATACTTGCCAATCTCGAGATTGGCAAGTATCGGTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012475.x-663s1c1
Sequence:CCGGGCCTTTCTACTCTGATGACAACTCGAGTTGTCATCAGAGTAGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012475.x-2015s1c1
Sequence:CCGGGACCCTCTGCAATATCACTTTCTCGAGAAAGTGATATTGCAGAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012475.x-533s1c1
Sequence:CCGGCCACTTTGAGACGTAGCACTTCTCGAGAAGTGCTACGTCTCAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012475.x-908s1c1
Sequence:CCGGCCTGCGAAGCTGTGAATCCTACTCGAGTAGGATTCACAGCTTCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012475.4-682s21c1
Sequence:CCGGCCACTTTGAGACGTAGCACTTCTCGAGAAGTGCTACGTCTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012475.4-1614s21c1
Sequence:CCGGGTGCTCCATCTGAATCGATTTCTCGAGAAATCGATTCAGATGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012475.4-2164s21c1
Sequence:CCGGGACCCTCTGCAATATCACTTTCTCGAGAAAGTGATATTGCAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012475.4-812s21c1
Sequence:CCGGGCCTTTCTACTCTGATGACAACTCGAGTTGTCATCAGAGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012475.4-541s21c1
Sequence:CCGGTCCCATCTCGGACCAACTTAGCTCGAGCTAAGTTGGTCCGAGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012475
VALIDATED
USP21 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 21
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012475.x-1057s1c1
Sequence:CCGGGCTCCACCGATACTTGCCAATCTCGAGATTGGCAAGTATCGGTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012475.x-663s1c1
Sequence:CCGGGCCTTTCTACTCTGATGACAACTCGAGTTGTCATCAGAGTAGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012475.x-2015s1c1
Sequence:CCGGGACCCTCTGCAATATCACTTTCTCGAGAAAGTGATATTGCAGAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012475.x-533s1c1
Sequence:CCGGCCACTTTGAGACGTAGCACTTCTCGAGAAGTGCTACGTCTCAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012475.x-908s1c1
Sequence:CCGGCCTGCGAAGCTGTGAATCCTACTCGAGTAGGATTCACAGCTTCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012475.4-682s21c1
Sequence:CCGGCCACTTTGAGACGTAGCACTTCTCGAGAAGTGCTACGTCTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012475.4-1614s21c1
Sequence:CCGGGTGCTCCATCTGAATCGATTTCTCGAGAAATCGATTCAGATGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012475.4-2164s21c1
Sequence:CCGGGACCCTCTGCAATATCACTTTCTCGAGAAAGTGATATTGCAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012475.4-812s21c1
Sequence:CCGGGCCTTTCTACTCTGATGACAACTCGAGTTGTCATCAGAGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012475.4-541s21c1
Sequence:CCGGTCCCATCTCGGACCAACTTAGCTCGAGCTAAGTTGGTCCGAGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012475
VALIDATED
USP21 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 21
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012475.x-1057s1c1
Sequence:CCGGGCTCCACCGATACTTGCCAATCTCGAGATTGGCAAGTATCGGTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012475.x-663s1c1
Sequence:CCGGGCCTTTCTACTCTGATGACAACTCGAGTTGTCATCAGAGTAGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012475.x-2015s1c1
Sequence:CCGGGACCCTCTGCAATATCACTTTCTCGAGAAAGTGATATTGCAGAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012475.x-533s1c1
Sequence:CCGGCCACTTTGAGACGTAGCACTTCTCGAGAAGTGCTACGTCTCAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012475.x-908s1c1
Sequence:CCGGCCTGCGAAGCTGTGAATCCTACTCGAGTAGGATTCACAGCTTCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012475.4-682s21c1
Sequence:CCGGCCACTTTGAGACGTAGCACTTCTCGAGAAGTGCTACGTCTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012475.4-1614s21c1
Sequence:CCGGGTGCTCCATCTGAATCGATTTCTCGAGAAATCGATTCAGATGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012475.4-2164s21c1
Sequence:CCGGGACCCTCTGCAATATCACTTTCTCGAGAAAGTGATATTGCAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012475.4-812s21c1
Sequence:CCGGGCCTTTCTACTCTGATGACAACTCGAGTTGTCATCAGAGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012475.4-541s21c1
Sequence:CCGGTCCCATCTCGGACCAACTTAGCTCGAGCTAAGTTGGTCCGAGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013919
VALIDATED
USP21 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 21
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-1072s1c1
Sequence:CCGGCCAGAAATACGTCCCTTCCTTCTCGAGAAGGAAGGGACGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-657s1c1
Sequence:CCGGCCACTTTGAGACGTAGTACTTCTCGAGAAGTACTACGTCTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-1273s1c1
Sequence:CCGGCCGAGCCAACTTAATGTGGAACTCGAGTTCCACATTAAGTTGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-385s1c1
Sequence:CCGGCCCAGATGAAAGGCTCAAGAACTCGAGTTCTTGAGCCTTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-1592s1c1
Sequence:CCGGGTGCTCCATCTGAACCGATTTCTCGAGAAATCGGTTCAGATGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013919.4-760s21c1
Sequence:CCGGATGGCTCCTTCCACATGATATCTCGAGATATCATGTGGAAGGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013919.4-395s21c1
Sequence:CCGGCCCAGATGAAAGGCTCAAGAACTCGAGTTCTTGAGCCTTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013919.4-1283s21c1
Sequence:CCGGCCGAGCCAACTTAATGTGGAACTCGAGTTCCACATTAAGTTGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013919.4-1602s21c1
Sequence:CCGGGTGCTCCATCTGAACCGATTTCTCGAGAAATCGGTTCAGATGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013919.4-667s21c1
Sequence:CCGGCCACTTTGAGACGTAGTACTTCTCGAGAAGTACTACGTCTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013919
VALIDATED
USP21 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 21
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-1072s1c1
Sequence:CCGGCCAGAAATACGTCCCTTCCTTCTCGAGAAGGAAGGGACGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-657s1c1
Sequence:CCGGCCACTTTGAGACGTAGTACTTCTCGAGAAGTACTACGTCTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-1273s1c1
Sequence:CCGGCCGAGCCAACTTAATGTGGAACTCGAGTTCCACATTAAGTTGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-385s1c1
Sequence:CCGGCCCAGATGAAAGGCTCAAGAACTCGAGTTCTTGAGCCTTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-1592s1c1
Sequence:CCGGGTGCTCCATCTGAACCGATTTCTCGAGAAATCGGTTCAGATGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013919.4-760s21c1
Sequence:CCGGATGGCTCCTTCCACATGATATCTCGAGATATCATGTGGAAGGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013919.4-395s21c1
Sequence:CCGGCCCAGATGAAAGGCTCAAGAACTCGAGTTCTTGAGCCTTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013919.4-1283s21c1
Sequence:CCGGCCGAGCCAACTTAATGTGGAACTCGAGTTCCACATTAAGTTGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013919.4-1602s21c1
Sequence:CCGGGTGCTCCATCTGAACCGATTTCTCGAGAAATCGGTTCAGATGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013919.4-667s21c1
Sequence:CCGGCCACTTTGAGACGTAGTACTTCTCGAGAAGTACTACGTCTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013919
VALIDATED
USP21 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 21
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-1072s1c1
Sequence:CCGGCCAGAAATACGTCCCTTCCTTCTCGAGAAGGAAGGGACGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-657s1c1
Sequence:CCGGCCACTTTGAGACGTAGTACTTCTCGAGAAGTACTACGTCTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-1273s1c1
Sequence:CCGGCCGAGCCAACTTAATGTGGAACTCGAGTTCCACATTAAGTTGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-385s1c1
Sequence:CCGGCCCAGATGAAAGGCTCAAGAACTCGAGTTCTTGAGCCTTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013919.2-1592s1c1
Sequence:CCGGGTGCTCCATCTGAACCGATTTCTCGAGAAATCGGTTCAGATGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013919.4-760s21c1
Sequence:CCGGATGGCTCCTTCCACATGATATCTCGAGATATCATGTGGAAGGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013919.4-395s21c1
Sequence:CCGGCCCAGATGAAAGGCTCAAGAACTCGAGTTCTTGAGCCTTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013919.4-1283s21c1
Sequence:CCGGCCGAGCCAACTTAATGTGGAACTCGAGTTCCACATTAAGTTGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013919.4-1602s21c1
Sequence:CCGGGTGCTCCATCTGAACCGATTTCTCGAGAAATCGGTTCAGATGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013919.4-667s21c1
Sequence:CCGGCCACTTTGAGACGTAGTACTTCTCGAGAAGTACTACGTCTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks