EMAIL THIS PAGE TO A FRIEND

USP22

ubiquitin specific peptidase 22

Synonyms: USP3L
UniProtKB ID: Q9UPT9, A0JNS3, Q2NLE2, Q6MZY4, Q8TBS8, Q96IW5
Gene ID:
Mouse(216825) ubiquitin specific peptidase 22
Rat(303201) ubiquitin specific peptidase 22
Zebrafish(692275) ubiquitin specific peptidase 22
Horse(100053238) ubiquitin specific peptidase 22
domestic cat(101089554) ubiquitin specific peptidase 22
dog(609588) ubiquitin specific peptidase 22
chicken(416501) ubiquitin specific peptidase 22
Domestic Rabbit(100340977) ubiquitin specific peptidase 22
naked mole-rat(101713936) ubiquitin specific peptidase 22
domestic guinea pig(100729060) ubiquitin specific peptidase 22
cow(509694) ubiquitin specific peptidase 22
sheep(101114202) ubiquitin specific peptidase 22
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004143 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004143 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004143 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015276 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_109894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_109894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_109894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_042698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_042698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_042698 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015276 Rosetta Predictions human pricing
XM_042698 Rosetta Predictions human pricing
XM_001077764 Rosetta Predictions rat pricing
XM_220534 Rosetta Predictions rat pricing
NM_001004143 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347438 predicted 1380
2 SASI_Hs02_00347439 predicted 735
3 SASI_Hs02_00347440 predicted 1373
4 SASI_Hs02_00347441 predicted 924
5 SASI_Hs02_00347442 predicted 1423
6 SASI_Hs02_00347443 predicted 1535
7 SASI_Hs02_00347444 predicted 1426
8 SASI_Hs02_00347445 predicted 1576
9 SASI_Hs02_00347446 predicted 1455
10 SASI_Hs02_00347447 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_042698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276309 predicted 405
2 SASI_Hs01_00276310 predicted 391
3 SASI_Hs01_00276311 predicted 1843
4 SASI_Hs01_00276312 predicted 1203
5 SASI_Hs01_00276313 predicted 1390
6 SASI_Hs01_00276314 predicted 1894
7 SASI_Hs01_00276315 predicted 2003
8 SASI_Hs01_00276316 predicted 1902
9 SASI_Hs01_00276317 predicted 2048
10 SASI_Hs01_00276318 predicted 2047
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077764 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358467 predicted 1564
2 SASI_Rn02_00358468 predicted 1616
3 SASI_Rn02_00358469 predicted 618
4 SASI_Rn02_00358470 predicted 1033
5 SASI_Rn02_00358471 predicted 1689
6 SASI_Rn02_00358472 predicted 1511
7 SASI_Rn02_00358473 predicted 1558
8 SASI_Rn02_00358474 predicted 1646
9 SASI_Rn02_00358475 predicted 909
10 SASI_Rn02_00358476 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379371 predicted 911
2 SASI_Rn02_00379372 predicted 1566
3 SASI_Rn02_00379373 predicted 1528
4 SASI_Rn02_00379374 predicted 1031
5 SASI_Rn02_00379375 predicted 1686
6 SASI_Rn02_00379376 predicted 1554
7 SASI_Rn02_00379377 predicted 1511
8 SASI_Rn02_00379378 predicted 1174
9 SASI_Rn02_00379379 predicted 1616
10 SASI_Rn02_00379380 predicted 1639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152285 predicted 1379
2 SASI_Mm02_00286449 predicted 1001
3 SASI_Mm02_00286450 predicted 1090
4 SASI_Mm01_00152287 predicted 490
5 SASI_Mm01_00152288 predicted 477
6 SASI_Mm01_00152289 predicted 1399
7 SASI_Mm01_00152290 predicted 1504
8 SASI_Mm01_00152291 predicted 535
9 SASI_Mm01_00152292 predicted 1381
10 SASI_Mm01_00152293 predicted 771
11 SASI_Mm01_00152284 predicted 1411
12 SASI_Mm01_00152286 predicted 1305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004143
VALIDATED
USP22 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004143.3-2210s21c1
Sequence:CCGGGCCACCCACAGGCTACAAATACTCGAGTATTTGTAGCCTGTGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004143.3-484s21c1
Sequence:CCGGGACCTGATGTACGGAGGTATTCTCGAGAATACCTCCGTACATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004143.3-1262s21c1
Sequence:CCGGCAGACTGCCTGCGAAGATTTACTCGAGTAAATCTTCGCAGGCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004143.3-1650s21c1
Sequence:CCGGCAAGTGTGATGACGCCATTATCTCGAGATAATGGCGTCATCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004143.3-1058s21c1
Sequence:CCGGGCATCATTGACCAGATCTTTACTCGAGTAAAGATCTGGTCAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004143
VALIDATED
USP22 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004143.3-2210s21c1
Sequence:CCGGGCCACCCACAGGCTACAAATACTCGAGTATTTGTAGCCTGTGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004143.3-484s21c1
Sequence:CCGGGACCTGATGTACGGAGGTATTCTCGAGAATACCTCCGTACATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004143.3-1262s21c1
Sequence:CCGGCAGACTGCCTGCGAAGATTTACTCGAGTAAATCTTCGCAGGCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004143.3-1650s21c1
Sequence:CCGGCAAGTGTGATGACGCCATTATCTCGAGATAATGGCGTCATCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004143.3-1058s21c1
Sequence:CCGGGCATCATTGACCAGATCTTTACTCGAGTAAAGATCTGGTCAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004143
VALIDATED
USP22 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004143.3-2210s21c1
Sequence:CCGGGCCACCCACAGGCTACAAATACTCGAGTATTTGTAGCCTGTGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004143.3-484s21c1
Sequence:CCGGGACCTGATGTACGGAGGTATTCTCGAGAATACCTCCGTACATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004143.3-1262s21c1
Sequence:CCGGCAGACTGCCTGCGAAGATTTACTCGAGTAAATCTTCGCAGGCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004143.3-1650s21c1
Sequence:CCGGCAAGTGTGATGACGCCATTATCTCGAGATAATGGCGTCATCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004143.3-1058s21c1
Sequence:CCGGGCATCATTGACCAGATCTTTACTCGAGTAAAGATCTGGTCAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015276
VALIDATED
USP22 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 22
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015276.1-1366s21c1
Sequence:CCGGAGCTACCAGGAGTCCACAAAGCTCGAGCTTTGTGGACTCCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015276.1-2145s21c1
Sequence:CCGGCCTACCTGCTGTAAGATTATGCTCGAGCATAATCTTACAGCAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015276.1-1734s21c1
Sequence:CCGGCGAAGGGTACTTGCTGTTCTACTCGAGTAGAACAGCAAGTACCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015276.1-1034s21c1
Sequence:CCGGACTGCAAAGGTGATGACAATGCTCGAGCATTGTCATCACCTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015276.1-545s21c1
Sequence:CCGGTGTGCCAGGACTACATCTATGCTCGAGCATAGATGTAGTCCTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015276
VALIDATED
USP22 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 22
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015276.1-1366s21c1
Sequence:CCGGAGCTACCAGGAGTCCACAAAGCTCGAGCTTTGTGGACTCCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015276.1-2145s21c1
Sequence:CCGGCCTACCTGCTGTAAGATTATGCTCGAGCATAATCTTACAGCAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015276.1-1734s21c1
Sequence:CCGGCGAAGGGTACTTGCTGTTCTACTCGAGTAGAACAGCAAGTACCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015276.1-1034s21c1
Sequence:CCGGACTGCAAAGGTGATGACAATGCTCGAGCATTGTCATCACCTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015276.1-545s21c1
Sequence:CCGGTGTGCCAGGACTACATCTATGCTCGAGCATAGATGTAGTCCTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015276
VALIDATED
USP22 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 22
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015276.1-1366s21c1
Sequence:CCGGAGCTACCAGGAGTCCACAAAGCTCGAGCTTTGTGGACTCCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015276.1-2145s21c1
Sequence:CCGGCCTACCTGCTGTAAGATTATGCTCGAGCATAATCTTACAGCAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015276.1-1734s21c1
Sequence:CCGGCGAAGGGTACTTGCTGTTCTACTCGAGTAGAACAGCAAGTACCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015276.1-1034s21c1
Sequence:CCGGACTGCAAAGGTGATGACAATGCTCGAGCATTGTCATCACCTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015276.1-545s21c1
Sequence:CCGGTGTGCCAGGACTACATCTATGCTCGAGCATAGATGTAGTCCTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_109894
VALIDATED
USP22 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109894.4-532s1c1
Sequence:CCGGGCTTGGAAGATGCAAGGTGTTCTCGAGAACACCTTGCATCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109894.4-439s1c1
Sequence:CCGGGACCTGATGTACGGAGGTATTCTCGAGAATACCTCCGTACATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109894.4-1534s1c1
Sequence:CCGGCGGCGGAAGATCACCACATATCTCGAGATATGTGGTGATCTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109894.4-1657s1c1
Sequence:CCGGGACAACAAATACTCCCTGTTTCTCGAGAAACAGGGAGTATTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109894.4-1035s1c1
Sequence:CCGGGCACTGCAAAGGTGATGACAACTCGAGTTGTCATCACCTTTGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_109894
VALIDATED
USP22 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109894.4-532s1c1
Sequence:CCGGGCTTGGAAGATGCAAGGTGTTCTCGAGAACACCTTGCATCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109894.4-439s1c1
Sequence:CCGGGACCTGATGTACGGAGGTATTCTCGAGAATACCTCCGTACATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109894.4-1534s1c1
Sequence:CCGGCGGCGGAAGATCACCACATATCTCGAGATATGTGGTGATCTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109894.4-1657s1c1
Sequence:CCGGGACAACAAATACTCCCTGTTTCTCGAGAAACAGGGAGTATTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109894.4-1035s1c1
Sequence:CCGGGCACTGCAAAGGTGATGACAACTCGAGTTGTCATCACCTTTGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_109894
VALIDATED
USP22 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109894.4-532s1c1
Sequence:CCGGGCTTGGAAGATGCAAGGTGTTCTCGAGAACACCTTGCATCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109894.4-439s1c1
Sequence:CCGGGACCTGATGTACGGAGGTATTCTCGAGAATACCTCCGTACATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109894.4-1534s1c1
Sequence:CCGGCGGCGGAAGATCACCACATATCTCGAGATATGTGGTGATCTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109894.4-1657s1c1
Sequence:CCGGGACAACAAATACTCCCTGTTTCTCGAGAAACAGGGAGTATTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109894.4-1035s1c1
Sequence:CCGGGCACTGCAAAGGTGATGACAACTCGAGTTGTCATCACCTTTGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_042698
VALIDATED
USP22 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 22
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042698.6-406s1c1
Sequence:CCGGCGGACTATACTGAGAGCCTATCTCGAGATAGGCTCTCAGTATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:XM_042698.6-2044s1c1
Sequence:CCGGGACAACAAGTATTCCCTGTTTCTCGAGAAACAGGGAATACTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:XM_042698.6-1921s1c1
Sequence:CCGGCGGCGGAAGATCACCACGTATCTCGAGATACGTGGTGATCTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042698.6-914s1c1
Sequence:CCGGGCTGTTTCACAAAGAAGCATACTCGAGTATGCTTCTTTGTGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:XM_042698.6-2196s1c1
Sequence:CCGGCGAAGGGTACTTGCTGTTCTACTCGAGTAGAACAGCAAGTACCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_042698
VALIDATED
USP22 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 22
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042698.6-406s1c1
Sequence:CCGGCGGACTATACTGAGAGCCTATCTCGAGATAGGCTCTCAGTATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:XM_042698.6-2044s1c1
Sequence:CCGGGACAACAAGTATTCCCTGTTTCTCGAGAAACAGGGAATACTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:XM_042698.6-1921s1c1
Sequence:CCGGCGGCGGAAGATCACCACGTATCTCGAGATACGTGGTGATCTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042698.6-914s1c1
Sequence:CCGGGCTGTTTCACAAAGAAGCATACTCGAGTATGCTTCTTTGTGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:XM_042698.6-2196s1c1
Sequence:CCGGCGAAGGGTACTTGCTGTTCTACTCGAGTAGAACAGCAAGTACCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_042698
VALIDATED
USP22 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 22
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042698.6-406s1c1
Sequence:CCGGCGGACTATACTGAGAGCCTATCTCGAGATAGGCTCTCAGTATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:XM_042698.6-2044s1c1
Sequence:CCGGGACAACAAGTATTCCCTGTTTCTCGAGAAACAGGGAATACTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:XM_042698.6-1921s1c1
Sequence:CCGGCGGCGGAAGATCACCACGTATCTCGAGATACGTGGTGATCTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_042698.6-914s1c1
Sequence:CCGGGCTGTTTCACAAAGAAGCATACTCGAGTATGCTTCTTTGTGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:XM_042698.6-2196s1c1
Sequence:CCGGCGAAGGGTACTTGCTGTTCTACTCGAGTAGAACAGCAAGTACCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks