EMAIL THIS PAGE TO A FRIEND

USP24

ubiquitin specific peptidase 24

UniProtKB ID: Q9UPU5, Q6ZSY2, Q8N2Y4, Q9NXD1
Gene ID:
Human(23358) Summary: Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]
Mouse(329908) ubiquitin specific peptidase 24
Rat(313427) ubiquitin specific peptidase 24
cow(532257) ubiquitin specific peptidase 24
sheep(101119525) ubiquitin specific peptidase 24
domestic guinea pig(100731262) ubiquitin specific peptidase 24
naked mole-rat(101701966) ubiquitin specific peptidase 24
Domestic Rabbit(100342458) ubiquitin specific peptidase 24
Zebrafish(325631) ubiquitin specific peptidase 24
Horse(100060124) ubiquitin specific peptidase 24
domestic cat(101095275) ubiquitin specific peptidase 24
dog(479558) ubiquitin specific peptidase 24
chicken(424665) ubiquitin specific peptidase 24
258 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300582 Anti-USP24 (C-term Y1427) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA pricing
SAB1300265 Anti-USP24 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1300264 Anti-USP24 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB1300581 Anti-USP24 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA pricing
SAB1407204 Anti-USP24 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA026723 Anti-USP24 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunofluorescence, immunohistochemistry, western blot pricing
HPA028428 Anti-USP24 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunofluorescence, immunohistochemistry, western blot pricing
HPA067124 Anti-USP24 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4500975 Anti-USP24, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_131566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_131566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_131566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_183225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015306 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015306 Rosetta Predictions human pricing
XM_371254 Rosetta Predictions human pricing
XM_934747 Rosetta Predictions human pricing
XM_934748 Rosetta Predictions human pricing
XM_934749 Rosetta Predictions human pricing
XM_001064937 Rosetta Predictions rat pricing
XM_233260 Rosetta Predictions rat pricing
XM_001481281 Rosetta Predictions mouse pricing
XM_131566 Rosetta Predictions mouse pricing
XM_915524 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347524 predicted 1017
2 SASI_Hs02_00347525 predicted 6064
3 SASI_Hs02_00347526 predicted 3502
4 SASI_Hs02_00347527 predicted 3262
5 SASI_Hs02_00347528 predicted 1068
6 SASI_Hs02_00347529 predicted 2737
7 SASI_Hs02_00347530 predicted 2081
8 SASI_Hs02_00347531 predicted 3135
9 SASI_Hs02_00347532 predicted 719
10 SASI_Hs02_00347533 predicted 7300
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292421 predicted 4731
2 SASI_Hs01_00292422 predicted 4893
3 SASI_Hs01_00292423 predicted 4915
4 SASI_Hs01_00292424 predicted 4693
5 SASI_Hs01_00292425 predicted 4782
6 SASI_Hs01_00292426 predicted 4554
7 SASI_Hs01_00292427 predicted 4544
8 SASI_Hs01_00292428 predicted 4800
9 SASI_Hs01_00292429 predicted 4642
10 SASI_Hs01_00292430 predicted 4561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270040 predicted 4221
2 SASI_Hs01_00270041 predicted 4382
3 SASI_Hs01_00270042 predicted 4414
4 SASI_Hs01_00270043 predicted 4187
5 SASI_Hs01_00270044 predicted 4274
6 SASI_Hs01_00270045 predicted 4045
7 SASI_Hs01_00270046 predicted 4037
8 SASI_Hs01_00270047 predicted 4286
9 SASI_Hs01_00270048 predicted 4132
10 SASI_Hs01_00270049 predicted 4048
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277391 predicted 1019
2 SASI_Hs01_00277392 predicted 1182
3 SASI_Hs01_00277393 predicted 1212
4 SASI_Hs01_00277394 predicted 981
5 SASI_Hs01_00277395 predicted 1075
6 SASI_Hs01_00277396 predicted 841
7 SASI_Hs01_00277397 predicted 838
8 SASI_Hs01_00277398 predicted 1090
9 SASI_Hs01_00277399 predicted 938
10 SASI_Hs01_00277400 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301651 predicted 636
2 SASI_Hs01_00301652 predicted 1269
3 SASI_Hs01_00301653 predicted 1137
4 SASI_Hs01_00301654 predicted 1055
5 SASI_Hs01_00301655 predicted 955
6 SASI_Hs01_00301656 predicted 1259
7 SASI_Hs01_00301657 predicted 749
8 SASI_Hs01_00301658 predicted 1145
9 SASI_Hs01_00301659 predicted 1261
10 SASI_Hs01_00301660 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312285 predicted 2416
2 SASI_Rn02_00312286 predicted 2187
3 SASI_Rn02_00312287 predicted 1555
4 SASI_Rn02_00312288 predicted 2884
5 SASI_Rn02_00312289 predicted 4140
6 SASI_Rn02_00312290 predicted 5410
7 SASI_Rn02_00312291 predicted 1993
8 SASI_Rn02_00312292 predicted 3749
9 SASI_Rn02_00312293 predicted 4622
10 SASI_Rn02_00312294 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387562 predicted 1549
2 SASI_Rn02_00387563 predicted 4140
3 SASI_Rn02_00387564 predicted 5403
4 SASI_Rn02_00387565 predicted 5126
5 SASI_Rn02_00387566 predicted 1996
6 SASI_Rn02_00387567 predicted 3749
7 SASI_Rn02_00387568 predicted 4626
8 SASI_Rn02_00387569 predicted 3098
9 SASI_Rn02_00387570 predicted 1138
10 SASI_Rn02_00387571 predicted 3612
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481281 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423374 predicted 1190
2 SASI_Mm02_00423375 predicted 3338
3 SASI_Mm02_00423376 predicted 2918
4 SASI_Mm02_00423377 predicted 2016
5 SASI_Mm02_00423378 predicted 5519
6 SASI_Mm02_00423379 predicted 5061
7 SASI_Mm02_00423380 predicted 4627
8 SASI_Mm02_00423381 predicted 6496
9 SASI_Mm02_00423382 predicted 5138
10 SASI_Mm02_00423383 predicted 2022
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212375 predicted 1001
2 SASI_Mm01_00212376 predicted 751
3 SASI_Mm01_00212377 predicted 5413
4 SASI_Mm01_00212378 predicted 778
5 SASI_Mm01_00212379 predicted 251
6 SASI_Mm01_00212380 predicted 3183
7 SASI_Mm01_00212381 predicted 2727
8 SASI_Mm01_00212382 predicted 4157
9 SASI_Mm01_00212383 predicted 2797
10 SASI_Mm01_00212384 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439537 predicted 376
2 SASI_Mm02_00439538 predicted 2519
3 SASI_Mm02_00439539 predicted 2093
4 SASI_Mm02_00439540 predicted 1203
5 SASI_Mm02_00439541 predicted 4701
6 SASI_Mm02_00439542 predicted 4244
7 SASI_Mm02_00439543 predicted 3812
8 SASI_Mm02_00439544 predicted 5679
9 SASI_Mm02_00439545 predicted 4317
10 SASI_Mm02_00439546 predicted 1210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_131566
VALIDATED
USP24 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 24
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_131566.5-782s1c1
Sequence:CCGGGCTGGATTCTTTAGGCAGAAACTCGAGTTTCTGCCTAAAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_131566.5-3702s1c1
Sequence:CCGGGCTTCCTTGAATGCTACTAAACTCGAGTTTAGTAGCATTCAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131566.5-2024s1c1
Sequence:CCGGGCTTGGTTCATCACTGATTAACTCGAGTTAATCAGTGATGAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131566.5-280s1c1
Sequence:CCGGCCTCATTTCATGGACATCTTTCTCGAGAAAGATGTCCATGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131566.5-5080s1c1
Sequence:CCGGCCATGATGATTGGTGAATTAACTCGAGTTAATTCACCAATCATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_131566
VALIDATED
USP24 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 24
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_131566.5-782s1c1
Sequence:CCGGGCTGGATTCTTTAGGCAGAAACTCGAGTTTCTGCCTAAAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_131566.5-3702s1c1
Sequence:CCGGGCTTCCTTGAATGCTACTAAACTCGAGTTTAGTAGCATTCAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131566.5-2024s1c1
Sequence:CCGGGCTTGGTTCATCACTGATTAACTCGAGTTAATCAGTGATGAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131566.5-280s1c1
Sequence:CCGGCCTCATTTCATGGACATCTTTCTCGAGAAAGATGTCCATGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131566.5-5080s1c1
Sequence:CCGGCCATGATGATTGGTGAATTAACTCGAGTTAATTCACCAATCATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_131566
VALIDATED
USP24 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 24
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_131566.5-782s1c1
Sequence:CCGGGCTGGATTCTTTAGGCAGAAACTCGAGTTTCTGCCTAAAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_131566.5-3702s1c1
Sequence:CCGGGCTTCCTTGAATGCTACTAAACTCGAGTTTAGTAGCATTCAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131566.5-2024s1c1
Sequence:CCGGGCTTGGTTCATCACTGATTAACTCGAGTTAATCAGTGATGAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131566.5-280s1c1
Sequence:CCGGCCTCATTTCATGGACATCTTTCTCGAGAAAGATGTCCATGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131566.5-5080s1c1
Sequence:CCGGCCATGATGATTGGTGAATTAACTCGAGTTAATTCACCAATCATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183225
VALIDATED
USP24 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 24
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183225.1-2229s1c1
Sequence:CCGGGCTCTAAGAATGATTCCATTTCTCGAGAAATGGAATCATTCTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183225.1-657s1c1
Sequence:CCGGTCATTGGTCTATCCCGTACAACTCGAGTTGTACGGGATAGACCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183225.1-620s1c1
Sequence:CCGGCCAATTTGTATGAGCTGGAAACTCGAGTTTCCAGCTCATACAAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183225.1-1327s1c1
Sequence:CCGGCCCGAGCTCTTGTCTGCCATTCTCGAGAATGGCAGACAAGAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183225.1-955s1c1
Sequence:CCGGCCTGATAATGAATACCACTTTCTCGAGAAAGTGGTATTCATTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183225.2-4298s21c1
Sequence:CCGGGGAAGTAGCCAGCCAATTAAACTCGAGTTTAATTGGCTGGCTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183225.2-4787s21c1
Sequence:CCGGGATTTGCGGTGCCAGTTATTACTCGAGTAATAACTGGCACCGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183225.2-1609s21c1
Sequence:CCGGACAATACTGTGATCGAATAAACTCGAGTTTATTCGATCACAGTATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183225.2-8355s21c1
Sequence:CCGGACTTGTGATTCATGGACATAGCTCGAGCTATGTCCATGAATCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183225.2-2806s21c1
Sequence:CCGATAATCTAAACCCTAGGTTAAACTCGAGTTTAACCTAGGGTTTAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183225.2-8465s21c1
Sequence:CCGGGAATAGGAATATCCAATTTACCTCGAGGTAAATTGGATATTCCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183225
VALIDATED
USP24 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 24
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183225.1-2229s1c1
Sequence:CCGGGCTCTAAGAATGATTCCATTTCTCGAGAAATGGAATCATTCTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183225.1-657s1c1
Sequence:CCGGTCATTGGTCTATCCCGTACAACTCGAGTTGTACGGGATAGACCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183225.1-620s1c1
Sequence:CCGGCCAATTTGTATGAGCTGGAAACTCGAGTTTCCAGCTCATACAAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183225.1-1327s1c1
Sequence:CCGGCCCGAGCTCTTGTCTGCCATTCTCGAGAATGGCAGACAAGAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183225.1-955s1c1
Sequence:CCGGCCTGATAATGAATACCACTTTCTCGAGAAAGTGGTATTCATTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183225.2-4298s21c1
Sequence:CCGGGGAAGTAGCCAGCCAATTAAACTCGAGTTTAATTGGCTGGCTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183225.2-4787s21c1
Sequence:CCGGGATTTGCGGTGCCAGTTATTACTCGAGTAATAACTGGCACCGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183225.2-1609s21c1
Sequence:CCGGACAATACTGTGATCGAATAAACTCGAGTTTATTCGATCACAGTATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183225.2-8355s21c1
Sequence:CCGGACTTGTGATTCATGGACATAGCTCGAGCTATGTCCATGAATCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183225.2-2806s21c1
Sequence:CCGATAATCTAAACCCTAGGTTAAACTCGAGTTTAACCTAGGGTTTAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183225.2-8465s21c1
Sequence:CCGGGAATAGGAATATCCAATTTACCTCGAGGTAAATTGGATATTCCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183225
VALIDATED
USP24 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 24
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183225.1-2229s1c1
Sequence:CCGGGCTCTAAGAATGATTCCATTTCTCGAGAAATGGAATCATTCTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183225.1-657s1c1
Sequence:CCGGTCATTGGTCTATCCCGTACAACTCGAGTTGTACGGGATAGACCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183225.1-620s1c1
Sequence:CCGGCCAATTTGTATGAGCTGGAAACTCGAGTTTCCAGCTCATACAAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183225.1-1327s1c1
Sequence:CCGGCCCGAGCTCTTGTCTGCCATTCTCGAGAATGGCAGACAAGAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_183225.1-955s1c1
Sequence:CCGGCCTGATAATGAATACCACTTTCTCGAGAAAGTGGTATTCATTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183225.2-4298s21c1
Sequence:CCGGGGAAGTAGCCAGCCAATTAAACTCGAGTTTAATTGGCTGGCTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183225.2-4787s21c1
Sequence:CCGGGATTTGCGGTGCCAGTTATTACTCGAGTAATAACTGGCACCGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183225.2-1609s21c1
Sequence:CCGGACAATACTGTGATCGAATAAACTCGAGTTTATTCGATCACAGTATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183225.2-8355s21c1
Sequence:CCGGACTTGTGATTCATGGACATAGCTCGAGCTATGTCCATGAATCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183225.2-2806s21c1
Sequence:CCGATAATCTAAACCCTAGGTTAAACTCGAGTTTAACCTAGGGTTTAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183225.2-8465s21c1
Sequence:CCGGGAATAGGAATATCCAATTTACCTCGAGGTAAATTGGATATTCCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015306
VALIDATED
USP24 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 24
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015306.1-2750s21c1
Sequence:CCGGCTCTCGTATGTAACGTATTTGCTCGAGCAAATACGTTACATACGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015306.1-2314s21c1
Sequence:CCGGGAGCGCTATGTGATCACTATACTCGAGTATAGTGATCACATAGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015306.1-1624s21c1
Sequence:CCGGTACACTTACCGGGAGTATTTACTCGAGTAAATACTCCCGGTAAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015306.1-1023s21c1
Sequence:CCGGACAATACTGTGACCGTATAAACTCGAGTTTATACGGTCACAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015306.1-9671s21c1
Sequence:CCGGCCTTAGTGAGGCCGATCTTAACTCGAGTTAAGATCGGCCTCACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015306
VALIDATED
USP24 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 24
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015306.1-2750s21c1
Sequence:CCGGCTCTCGTATGTAACGTATTTGCTCGAGCAAATACGTTACATACGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015306.1-2314s21c1
Sequence:CCGGGAGCGCTATGTGATCACTATACTCGAGTATAGTGATCACATAGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015306.1-1624s21c1
Sequence:CCGGTACACTTACCGGGAGTATTTACTCGAGTAAATACTCCCGGTAAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015306.1-1023s21c1
Sequence:CCGGACAATACTGTGACCGTATAAACTCGAGTTTATACGGTCACAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015306.1-9671s21c1
Sequence:CCGGCCTTAGTGAGGCCGATCTTAACTCGAGTTAAGATCGGCCTCACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015306
VALIDATED
USP24 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 24
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015306.1-2750s21c1
Sequence:CCGGCTCTCGTATGTAACGTATTTGCTCGAGCAAATACGTTACATACGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015306.1-2314s21c1
Sequence:CCGGGAGCGCTATGTGATCACTATACTCGAGTATAGTGATCACATAGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015306.1-1624s21c1
Sequence:CCGGTACACTTACCGGGAGTATTTACTCGAGTAAATACTCCCGGTAAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015306.1-1023s21c1
Sequence:CCGGACAATACTGTGACCGTATAAACTCGAGTTTATACGGTCACAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015306.1-9671s21c1
Sequence:CCGGCCTTAGTGAGGCCGATCTTAACTCGAGTTAAGATCGGCCTCACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks