EMAIL THIS PAGE TO A FRIEND

USP25

ubiquitin specific peptidase 25

Synonyms: USP21
UniProtKB ID: Q9UHP3, C0LSZ0, Q6DHZ9, Q9H9W1
Gene ID:
Human(29761) Summary: Ubiquitin (MIM 191339) is a highly conserved 76-amino acid protein involved in regulation of intracellular protein breakdown, cell cycle regulation, and stress response. Ubiquitin is released from degraded proteins by disassembly of the polyubiquitin chains, which is mediated by ubiquitin-specific proteases (USPs), such as USP25 (Valero et al., 1999 [PubMed 10644437]
Mouse(30940) ubiquitin specific peptidase 25
Rat(304150) ubiquitin specific peptidase 25
Zebrafish(406790) ubiquitin specific protease 25
chicken(418471) ubiquitin specific peptidase 25
dog(478387) ubiquitin specific peptidase 25
Domestic Rabbit(100348335) ubiquitin specific peptidase 25
naked mole-rat(101714698) ubiquitin specific peptidase 25
domestic guinea pig(100730631) ubiquitin specific peptidase 25
cow(524531) ubiquitin specific peptidase 25
sheep(101116878) ubiquitin specific peptidase 25
136 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013396 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013396 Rosetta Predictions human pricing
NM_001107114 Rosetta Predictions rat pricing
NM_013918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344762 predicted 1525
2 SASI_Hs01_00191397 predicted 1480
3 SASI_Hs01_00191398 predicted 2965
4 SASI_Hs02_00344763 predicted 1610
5 SASI_Hs01_00191399 predicted 991
6 SASI_Hs01_00191400 predicted 2195
7 SASI_Hs02_00344764 predicted 2991
8 SASI_Hs02_00344765 predicted 944
9 SASI_Hs01_00191403 predicted 1770
10 SASI_Hs01_00191404 predicted 706
11 SASI_Hs01_00191396 predicted 587
12 SASI_Hs01_00191401 predicted 1018
13 SASI_Hs01_00191402 predicted 3184
14 SASI_Hs01_00191405 predicted 1725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225636 predicted 1204
2 SASI_Rn02_00225637 predicted 709
3 SASI_Rn02_00225638 predicted 1895
4 SASI_Rn02_00225639 predicted 2671
5 SASI_Rn02_00225640 predicted 948
6 SASI_Rn02_00225641 predicted 750
7 SASI_Rn02_00225642 predicted 1609
8 SASI_Rn02_00225643 predicted 2867
9 SASI_Rn02_00225644 predicted 2917
10 SASI_Rn02_00225645 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198868 predicted 2722
2 SASI_Mm01_00198869 predicted 1887
3 SASI_Mm01_00198870 predicted 804
4 SASI_Mm01_00198871 predicted 2012
5 SASI_Mm01_00198872 predicted 562
6 SASI_Mm01_00198873 predicted 600
7 SASI_Mm01_00198874 predicted 832
8 SASI_Mm01_00198875 predicted 568
9 SASI_Mm02_00323012 predicted 1474
10 SASI_Mm02_00323013 predicted 2289
11 SASI_Mm01_00198876 predicted 531
12 SASI_Mm01_00198877 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013396
VALIDATED
USP25 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 25
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013396.3-2908s21c1
Sequence:CCGGGCTGTTCCTCATCTGTGCTTACTCGAGTAAGCACAGATGAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013396.3-3158s21c1
Sequence:CCGGGCTGTAGAAGATATGAGAAATCTCGAGATTTCTCATATCTTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013396.3-883s21c1
Sequence:CCGGGCGTGAGCTGAGGTATCTATTCTCGAGAATAGATACCTCAGCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013396.3-1611s21c1
Sequence:CCGGGCACTTCTCCTGTTGACGATACTCGAGTATCGTCAACAGGAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-1763s1c1
Sequence:CCGGGCACTTCTCCTGTTGACGATACTCGAGTATCGTCAACAGGAGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-1035s1c1
Sequence:CCGGGCGTGAGCTGAGGTATCTATTCTCGAGAATAGATACCTCAGCTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-4937s1c1
Sequence:CCGGTGGAGGAGTAAGATGAAATATCTCGAGATATTTCATCTTACTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-3156s1c1
Sequence:CCGGGCTGTTCCTCATCTGTGCTTACTCGAGTAAGCACAGATGAGGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-3406s1c1
Sequence:CCGGGCTGTAGAAGATATGAGAAATCTCGAGATTTCTCATATCTTCTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013396
VALIDATED
USP25 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 25
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013396.3-2908s21c1
Sequence:CCGGGCTGTTCCTCATCTGTGCTTACTCGAGTAAGCACAGATGAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013396.3-3158s21c1
Sequence:CCGGGCTGTAGAAGATATGAGAAATCTCGAGATTTCTCATATCTTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013396.3-883s21c1
Sequence:CCGGGCGTGAGCTGAGGTATCTATTCTCGAGAATAGATACCTCAGCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013396.3-1611s21c1
Sequence:CCGGGCACTTCTCCTGTTGACGATACTCGAGTATCGTCAACAGGAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-1763s1c1
Sequence:CCGGGCACTTCTCCTGTTGACGATACTCGAGTATCGTCAACAGGAGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-1035s1c1
Sequence:CCGGGCGTGAGCTGAGGTATCTATTCTCGAGAATAGATACCTCAGCTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-4937s1c1
Sequence:CCGGTGGAGGAGTAAGATGAAATATCTCGAGATATTTCATCTTACTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-3156s1c1
Sequence:CCGGGCTGTTCCTCATCTGTGCTTACTCGAGTAAGCACAGATGAGGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-3406s1c1
Sequence:CCGGGCTGTAGAAGATATGAGAAATCTCGAGATTTCTCATATCTTCTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013396
VALIDATED
USP25 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 25
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013396.3-2908s21c1
Sequence:CCGGGCTGTTCCTCATCTGTGCTTACTCGAGTAAGCACAGATGAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013396.3-3158s21c1
Sequence:CCGGGCTGTAGAAGATATGAGAAATCTCGAGATTTCTCATATCTTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013396.3-883s21c1
Sequence:CCGGGCGTGAGCTGAGGTATCTATTCTCGAGAATAGATACCTCAGCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013396.3-1611s21c1
Sequence:CCGGGCACTTCTCCTGTTGACGATACTCGAGTATCGTCAACAGGAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-1763s1c1
Sequence:CCGGGCACTTCTCCTGTTGACGATACTCGAGTATCGTCAACAGGAGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-1035s1c1
Sequence:CCGGGCGTGAGCTGAGGTATCTATTCTCGAGAATAGATACCTCAGCTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-4937s1c1
Sequence:CCGGTGGAGGAGTAAGATGAAATATCTCGAGATATTTCATCTTACTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-3156s1c1
Sequence:CCGGGCTGTTCCTCATCTGTGCTTACTCGAGTAAGCACAGATGAGGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013396.x-3406s1c1
Sequence:CCGGGCTGTAGAAGATATGAGAAATCTCGAGATTTCTCATATCTTCTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013918
VALIDATED
USP25 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 25
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-1687s21c1
Sequence:CCGGCATCGCTGGAGGACGGAAATACTCGAGTATTTCCGTCCTCCAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-2875s21c1
Sequence:CCGGGACGTGAACAATGGCTTAATTCTCGAGAATTAAGCCATTGTTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-3723s21c1
Sequence:CCGGTAGTATAATGGAACCATATTGCTCGAGCAATATGGTTCCATTATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-2622s21c1
Sequence:CCGGGGAGTGGCATGCAGATTATAACTCGAGTTATAATCTGCATGCCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-1222s21c1
Sequence:CCGGTTATATCTGGACAGGTATATGCTCGAGCATATACCTGTCCAGATATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013918.2-3063s1c1
Sequence:CCGGGCTTGATTGTTCTACAGAGATCTCGAGATCTCTGTAGAACAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013918.2-557s1c1
Sequence:CCGGCCTGCTGGTTTAGTGCAGTTACTCGAGTAACTGCACTAAACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013918.2-1885s1c1
Sequence:CCGGCGGTGGATGAAGTATAATGATCTCGAGATCATTATACTTCATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013918.2-286s1c1
Sequence:CCGGGCAGATGCAAATGTAATTGATCTCGAGATCAATTACATTTGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013918.2-2153s1c1
Sequence:CCGGCCCAACGATCACTGCAAGAAACTCGAGTTTCTTGCAGTGATCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013918
VALIDATED
USP25 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 25
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-1687s21c1
Sequence:CCGGCATCGCTGGAGGACGGAAATACTCGAGTATTTCCGTCCTCCAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-2875s21c1
Sequence:CCGGGACGTGAACAATGGCTTAATTCTCGAGAATTAAGCCATTGTTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-3723s21c1
Sequence:CCGGTAGTATAATGGAACCATATTGCTCGAGCAATATGGTTCCATTATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-2622s21c1
Sequence:CCGGGGAGTGGCATGCAGATTATAACTCGAGTTATAATCTGCATGCCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-1222s21c1
Sequence:CCGGTTATATCTGGACAGGTATATGCTCGAGCATATACCTGTCCAGATATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013918.2-3063s1c1
Sequence:CCGGGCTTGATTGTTCTACAGAGATCTCGAGATCTCTGTAGAACAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013918.2-557s1c1
Sequence:CCGGCCTGCTGGTTTAGTGCAGTTACTCGAGTAACTGCACTAAACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013918.2-1885s1c1
Sequence:CCGGCGGTGGATGAAGTATAATGATCTCGAGATCATTATACTTCATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013918.2-286s1c1
Sequence:CCGGGCAGATGCAAATGTAATTGATCTCGAGATCAATTACATTTGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013918.2-2153s1c1
Sequence:CCGGCCCAACGATCACTGCAAGAAACTCGAGTTTCTTGCAGTGATCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013918
VALIDATED
USP25 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 25
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-1687s21c1
Sequence:CCGGCATCGCTGGAGGACGGAAATACTCGAGTATTTCCGTCCTCCAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-2875s21c1
Sequence:CCGGGACGTGAACAATGGCTTAATTCTCGAGAATTAAGCCATTGTTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-3723s21c1
Sequence:CCGGTAGTATAATGGAACCATATTGCTCGAGCAATATGGTTCCATTATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-2622s21c1
Sequence:CCGGGGAGTGGCATGCAGATTATAACTCGAGTTATAATCTGCATGCCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013918.2-1222s21c1
Sequence:CCGGTTATATCTGGACAGGTATATGCTCGAGCATATACCTGTCCAGATATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013918.2-3063s1c1
Sequence:CCGGGCTTGATTGTTCTACAGAGATCTCGAGATCTCTGTAGAACAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013918.2-557s1c1
Sequence:CCGGCCTGCTGGTTTAGTGCAGTTACTCGAGTAACTGCACTAAACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013918.2-1885s1c1
Sequence:CCGGCGGTGGATGAAGTATAATGATCTCGAGATCATTATACTTCATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013918.2-286s1c1
Sequence:CCGGGCAGATGCAAATGTAATTGATCTCGAGATCAATTACATTTGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013918.2-2153s1c1
Sequence:CCGGCCCAACGATCACTGCAAGAAACTCGAGTTTCTTGCAGTGATCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks