EMAIL THIS PAGE TO A FRIEND

USP26

ubiquitin specific peptidase 26

UniProtKB ID: Q9BXU7, B9WRT6, Q5H9H4
Gene ID:
Human(83844) Summary: This gene encodes a member of the ubiquitin-specific processing (UBP) family of proteases and is a deubiquitinating enzyme (DUB) with His and Cys domains. It is specifically expressed in testis tissue. Mutations in this gene have been associated with Sertoli cell-only syndrome and male infertility. [provided by RefSeq, Jul 2008]
Mouse(83563) ubiquitin specific peptidase 26
Rat(302488) ubiquitin specific peptidase 26
cow(517081) ubiquitin specific peptidase 26
sheep(101119540) ubiquitin specific peptidase 26
domestic guinea pig(100725433) ubiquitin specific peptidase 26
naked mole-rat(101703537) ubiquitin specific peptidase 26
Domestic Rabbit(100344862) ubiquitin specific peptidase 26
domestic cat(101094246) ubiquitin specific peptidase 26
Horse(100057231) ubiquitin specific peptidase 26
dog(492143) ubiquitin specific peptidase 26
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031388 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031388 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031388 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031907 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031907 Rosetta Predictions human pricing
NM_001106948 Rosetta Predictions rat pricing
NM_031388 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043149 predicted 2385
2 SASI_Hs01_00043150 predicted 2543
3 SASI_Hs01_00043151 predicted 549
4 SASI_Hs01_00043152 predicted 2496
5 SASI_Hs01_00043153 predicted 779
6 SASI_Hs01_00043154 predicted 672
7 SASI_Hs01_00043155 predicted 2512
8 SASI_Hs01_00043156 predicted 2194
9 SASI_Hs01_00043157 predicted 2506
10 SASI_Hs02_00359034 predicted 2391
11 SASI_Hs01_00043158 predicted 2412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106948 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223986 predicted 2620
2 SASI_Rn02_00223987 predicted 2032
3 SASI_Rn02_00223988 predicted 2780
4 SASI_Rn02_00223989 predicted 2405
5 SASI_Rn02_00223990 predicted 1409
6 SASI_Rn02_00223991 predicted 2558
7 SASI_Rn02_00223992 predicted 2085
8 SASI_Rn02_00223993 predicted 1578
9 SASI_Rn02_00223994 predicted 3161
10 SASI_Rn02_00223995 predicted 1879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117337 predicted 352
2 SASI_Mm01_00117338 predicted 2703
3 SASI_Mm01_00117339 predicted 2236
4 SASI_Mm01_00117340 predicted 2405
5 SASI_Mm02_00337134 predicted 2837
6 SASI_Mm01_00117341 predicted 1645
7 SASI_Mm01_00117342 predicted 2790
8 SASI_Mm01_00117343 predicted 360
9 SASI_Mm01_00117344 predicted 2891
10 SASI_Mm01_00117345 predicted 1201
11 SASI_Mm01_00117346 predicted 1818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031388
USP26 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 26
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031388.1-419s1c1
Sequence:CCGGGCACTGGAAAGATTAAGACTTCTCGAGAAGTCTTAATCTTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031388.1-1021s1c1
Sequence:CCGGCGTGATCTTAATGATCTCATTCTCGAGAATGAGATCATTAAGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031388.1-2932s1c1
Sequence:CCGGCCTGACCACATCAGTCTTATACTCGAGTATAAGACTGATGTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031388.1-2170s1c1
Sequence:CCGGGCACATATAGTTGGGTCAGAACTCGAGTTCTGACCCAACTATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031388.1-1323s1c1
Sequence:CCGGCGCAAGATTTAGACAGAAGTTCTCGAGAACTTCTGTCTAAATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031388.2-3562s21c1
Sequence:CCGGTTCTTGCATGGCAGCATAATACTCGAGTATTATGCTGCCATGCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031388.2-2394s21c1
Sequence:CCGGGAAGTGTTGGGTTCCGAAATACTCGAGTATTTCGGAACCCAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031388
USP26 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 26
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031388.1-419s1c1
Sequence:CCGGGCACTGGAAAGATTAAGACTTCTCGAGAAGTCTTAATCTTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031388.1-1021s1c1
Sequence:CCGGCGTGATCTTAATGATCTCATTCTCGAGAATGAGATCATTAAGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031388.1-2932s1c1
Sequence:CCGGCCTGACCACATCAGTCTTATACTCGAGTATAAGACTGATGTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031388.1-2170s1c1
Sequence:CCGGGCACATATAGTTGGGTCAGAACTCGAGTTCTGACCCAACTATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031388.1-1323s1c1
Sequence:CCGGCGCAAGATTTAGACAGAAGTTCTCGAGAACTTCTGTCTAAATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031388.2-3562s21c1
Sequence:CCGGTTCTTGCATGGCAGCATAATACTCGAGTATTATGCTGCCATGCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031388.2-2394s21c1
Sequence:CCGGGAAGTGTTGGGTTCCGAAATACTCGAGTATTTCGGAACCCAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031388
USP26 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 26
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031388.1-419s1c1
Sequence:CCGGGCACTGGAAAGATTAAGACTTCTCGAGAAGTCTTAATCTTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031388.1-1021s1c1
Sequence:CCGGCGTGATCTTAATGATCTCATTCTCGAGAATGAGATCATTAAGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031388.1-2932s1c1
Sequence:CCGGCCTGACCACATCAGTCTTATACTCGAGTATAAGACTGATGTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031388.1-2170s1c1
Sequence:CCGGGCACATATAGTTGGGTCAGAACTCGAGTTCTGACCCAACTATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031388.1-1323s1c1
Sequence:CCGGCGCAAGATTTAGACAGAAGTTCTCGAGAACTTCTGTCTAAATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031388.2-3562s21c1
Sequence:CCGGTTCTTGCATGGCAGCATAATACTCGAGTATTATGCTGCCATGCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031388.2-2394s21c1
Sequence:CCGGGAAGTGTTGGGTTCCGAAATACTCGAGTATTTCGGAACCCAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031907
USP26 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 26
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-696s1c1
Sequence:CCGGGCTATAATCGAGAGAAACAATCTCGAGATTGTTTCTCTCGATTATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-674s1c1
Sequence:CCGGGCAGATTGTTCGAGGTGTGTACTCGAGTACACACCTCGAACAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-1229s1c1
Sequence:CCGGCAACTGAAAGATAACATGGAACTCGAGTTCCATGTTATCTTTCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-989s1c1
Sequence:CCGGCTACTTTCAATCCCATCGTTTCTCGAGAAACGATGGGATTGAAAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-2437s1c1
Sequence:CCGGGAATCCAAGAAACAAAGACATCTCGAGATGTCTTTGTTTCTTGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031907.1-1562s21c1
Sequence:CCGGTCCGTTGGAGTGCACTCATTCCTCGAGGAATGAGTGCACTCCAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031907.1-549s21c1
Sequence:CCGGCACTTACTTGCGGAGAGTTATCTCGAGATAACTCTCCGCAAGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031907.1-876s21c1
Sequence:CCGGGTTACACAAAGTGGGATAAATCTCGAGATTTATCCCACTTTGTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031907
USP26 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 26
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-696s1c1
Sequence:CCGGGCTATAATCGAGAGAAACAATCTCGAGATTGTTTCTCTCGATTATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-674s1c1
Sequence:CCGGGCAGATTGTTCGAGGTGTGTACTCGAGTACACACCTCGAACAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-1229s1c1
Sequence:CCGGCAACTGAAAGATAACATGGAACTCGAGTTCCATGTTATCTTTCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-989s1c1
Sequence:CCGGCTACTTTCAATCCCATCGTTTCTCGAGAAACGATGGGATTGAAAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-2437s1c1
Sequence:CCGGGAATCCAAGAAACAAAGACATCTCGAGATGTCTTTGTTTCTTGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031907.1-1562s21c1
Sequence:CCGGTCCGTTGGAGTGCACTCATTCCTCGAGGAATGAGTGCACTCCAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031907.1-549s21c1
Sequence:CCGGCACTTACTTGCGGAGAGTTATCTCGAGATAACTCTCCGCAAGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031907.1-876s21c1
Sequence:CCGGGTTACACAAAGTGGGATAAATCTCGAGATTTATCCCACTTTGTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031907
USP26 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 26
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-696s1c1
Sequence:CCGGGCTATAATCGAGAGAAACAATCTCGAGATTGTTTCTCTCGATTATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-674s1c1
Sequence:CCGGGCAGATTGTTCGAGGTGTGTACTCGAGTACACACCTCGAACAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-1229s1c1
Sequence:CCGGCAACTGAAAGATAACATGGAACTCGAGTTCCATGTTATCTTTCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-989s1c1
Sequence:CCGGCTACTTTCAATCCCATCGTTTCTCGAGAAACGATGGGATTGAAAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031907.1-2437s1c1
Sequence:CCGGGAATCCAAGAAACAAAGACATCTCGAGATGTCTTTGTTTCTTGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031907.1-1562s21c1
Sequence:CCGGTCCGTTGGAGTGCACTCATTCCTCGAGGAATGAGTGCACTCCAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031907.1-549s21c1
Sequence:CCGGCACTTACTTGCGGAGAGTTATCTCGAGATAACTCTCCGCAAGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031907.1-876s21c1
Sequence:CCGGGTTACACAAAGTGGGATAAATCTCGAGATTTATCCCACTTTGTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks