EMAIL THIS PAGE TO A FRIEND

USP27X-AS1

USP27X antisense RNA 1 (head to head)

Species: Human USP27X-AS1(158572)
Gene ID:
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_379705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_379705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_379705 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025449 Rosetta Predictions human pricing
XR_040912 Rosetta Predictions human pricing
XR_040913 Rosetta Predictions human pricing
XR_040914 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043999 predicted 199
2 SASI_Hs01_00044000 predicted 210
3 SASI_Hs01_00044001 predicted 205
4 SASI_Hs01_00044002 predicted 208
5 SASI_Hs01_00044003 predicted 200
6 SASI_Hs01_00044004 predicted 211
7 SASI_Hs01_00044005 predicted 126
8 SASI_Hs01_00044006 predicted 138
9 SASI_Hs01_00044007 predicted 365
10 SASI_Hs01_00044008 predicted 136
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523060 predicted 207
2 SASI_Hs02_00523061 predicted 605
3 SASI_Hs02_00523062 predicted 315
4 SASI_Hs02_00523063 predicted 629
5 SASI_Hs02_00523064 predicted 517
6 SASI_Hs02_00523065 predicted 260
7 SASI_Hs02_00523066 predicted 628
8 SASI_Hs02_00523067 predicted 601
9 SASI_Hs02_00523068 predicted 633
10 SASI_Hs02_00523069 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523070 predicted 201
2 SASI_Hs02_00523071 predicted 611
3 SASI_Hs02_00523072 predicted 313
4 SASI_Hs02_00523073 predicted 632
5 SASI_Hs02_00523074 predicted 520
6 SASI_Hs02_00523075 predicted 261
7 SASI_Hs02_00523076 predicted 621
8 SASI_Hs02_00523077 predicted 601
9 SASI_Hs02_00523078 predicted 625
10 SASI_Hs02_00523079 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523080 predicted 204
2 SASI_Hs02_00523081 predicted 610
3 SASI_Hs02_00523082 predicted 313
4 SASI_Hs02_00523083 predicted 633
5 SASI_Hs02_00523084 predicted 521
6 SASI_Hs02_00523085 predicted 266
7 SASI_Hs02_00523086 predicted 627
8 SASI_Hs02_00523087 predicted 603
9 SASI_Hs02_00523088 predicted 626
10 SASI_Hs02_00523089 predicted 628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_379705
USP27X-AS1 MISSION shRNA Bacterial Glycerol Stock
USP27X antisense RNA 1 (head to head)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1346s1c1
Sequence:CCGGCCATGGTAACTTGTTGACTTACTCGAGTAAGTCAACAAGTTACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1449s1c1
Sequence:CCGGCCATTCACTCAACAAATGTTTCTCGAGAAACATTTGTTGAGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1102s1c1
Sequence:CCGGCTCTTGCTTCAATTCCTTGAACTCGAGTTCAAGGAATTGAAGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1445s1c1
Sequence:CCGGGTCACCATTCACTCAACAAATCTCGAGATTTGTTGAGTGAATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186976    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1329s1c1
Sequence:CCGGCTACCATTGAAGATTAGCCATCTCGAGATGGCTAATCTTCAATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1345s1c1
Sequence:CCGGGCCATGGTAACTTGTTGACTTCTCGAGAAGTCAACAAGTTACCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_379705
USP27X-AS1 MISSION shRNA shRNA Plasmid DNA
USP27X antisense RNA 1 (head to head)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1346s1c1
Sequence:CCGGCCATGGTAACTTGTTGACTTACTCGAGTAAGTCAACAAGTTACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1449s1c1
Sequence:CCGGCCATTCACTCAACAAATGTTTCTCGAGAAACATTTGTTGAGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1102s1c1
Sequence:CCGGCTCTTGCTTCAATTCCTTGAACTCGAGTTCAAGGAATTGAAGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1445s1c1
Sequence:CCGGGTCACCATTCACTCAACAAATCTCGAGATTTGTTGAGTGAATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186976    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1329s1c1
Sequence:CCGGCTACCATTGAAGATTAGCCATCTCGAGATGGCTAATCTTCAATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1345s1c1
Sequence:CCGGGCCATGGTAACTTGTTGACTTCTCGAGAAGTCAACAAGTTACCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_379705
USP27X-AS1 MISSION shRNA Lentiviral Transduction Particles
USP27X antisense RNA 1 (head to head)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1346s1c1
Sequence:CCGGCCATGGTAACTTGTTGACTTACTCGAGTAAGTCAACAAGTTACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1449s1c1
Sequence:CCGGCCATTCACTCAACAAATGTTTCTCGAGAAACATTTGTTGAGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1102s1c1
Sequence:CCGGCTCTTGCTTCAATTCCTTGAACTCGAGTTCAAGGAATTGAAGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1445s1c1
Sequence:CCGGGTCACCATTCACTCAACAAATCTCGAGATTTGTTGAGTGAATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186976    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1329s1c1
Sequence:CCGGCTACCATTGAAGATTAGCCATCTCGAGATGGCTAATCTTCAATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_379705.1-1345s1c1
Sequence:CCGGGCCATGGTAACTTGTTGACTTCTCGAGAAGTCAACAAGTTACCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks