EMAIL THIS PAGE TO A FRIEND

USP27X

ubiquitin specific peptidase 27, X-linked

Synonyms: USP22L USP27
UniProtKB ID: A6NNY8
Gene ID:
Mouse(54651) ubiquitin specific peptidase 27, X chromosome
Rat(302566) ubiquitin specific peptidase 27, X-linked
dog(491879) ubiquitin specific peptidase 27, X-linked
cow(781718) ubiquitin specific peptidase 27, X-linked
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145073 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019461 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019461 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019461 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU208731 MISSION® esiRNA esiRNA targeting mouse Usp27x mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714049 Rosetta Predictions human pricing
XM_372213 Rosetta Predictions human pricing
XM_937860 Rosetta Predictions human pricing
XM_228777 Rosetta Predictions rat pricing
XR_008155 Rosetta Predictions rat pricing
NM_019461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00394607 predicted 653
2 SASI_Hs02_00394608 predicted 317
3 SASI_Hs02_00394609 predicted 733
4 SASI_Hs02_00394610 predicted 1558
5 SASI_Hs02_00394611 predicted 1413
6 SASI_Hs02_00394612 predicted 798
7 SASI_Hs02_00394613 predicted 297
8 SASI_Hs02_00394614 predicted 1287
9 SASI_Hs02_00394615 predicted 574
10 SASI_Hs02_00394616 predicted 1384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262009 predicted 994
2 SASI_Hs01_00262010 predicted 670
3 SASI_Hs01_00262012 predicted 1076
4 SASI_Hs02_00479372 predicted 1911
5 SASI_Hs01_00262013 predicted 1760
6 SASI_Hs01_00262014 predicted 1151
7 SASI_Hs01_00262016 predicted 645
8 SASI_Hs01_00262017 predicted 1628
9 SASI_Hs01_00262018 predicted 925
10 SASI_Hs02_00479373 predicted 1737
11 SASI_Hs01_00262011 predicted 1332
12 SASI_Hs01_00262015 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482739 predicted 998
2 SASI_Hs02_00482740 predicted 672
3 SASI_Hs02_00482741 predicted 1079
4 SASI_Hs02_00482742 predicted 1907
5 SASI_Hs02_00482743 predicted 1763
6 SASI_Hs02_00482744 predicted 1149
7 SASI_Hs02_00482745 predicted 643
8 SASI_Hs02_00482746 predicted 1637
9 SASI_Hs02_00482747 predicted 924
10 SASI_Hs02_00482748 predicted 1733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385487 predicted 208
2 SASI_Rn02_00385488 predicted 212
3 SASI_Rn02_00385489 predicted 1859
4 SASI_Rn02_00385490 predicted 1353
5 SASI_Rn02_00385491 predicted 1290
6 SASI_Rn02_00385492 predicted 1724
7 SASI_Rn02_00385493 predicted 885
8 SASI_Rn02_00385494 predicted 1913
9 SASI_Rn02_00385495 predicted 2115
10 SASI_Rn02_00385496 predicted 2274
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141842 predicted 1315
2 SASI_Rn02_00416353 predicted 2443
3 SASI_Rn01_00141844 predicted 803
4 SASI_Rn01_00141845 predicted 735
5 SASI_Rn01_00141846 predicted 1171
6 SASI_Rn01_00141847 predicted 336
7 SASI_Rn01_00141848 predicted 1357
8 SASI_Rn02_00416354 predicted 2039
9 SASI_Rn01_00141849 predicted 1344
10 SASI_Rn01_00141851 predicted 676
11 SASI_Rn01_00141843 predicted 1435
12 SASI_Rn01_00141850 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051083 predicted 2025
2 SASI_Mm01_00051084 predicted 2044
3 SASI_Mm01_00051085 predicted 2139
4 SASI_Mm01_00051086 predicted 2163
5 SASI_Mm01_00051087 predicted 1932
6 SASI_Mm01_00051088 predicted 953
7 SASI_Mm01_00051089 predicted 1774
8 SASI_Mm01_00051090 predicted 1421
9 SASI_Mm01_00051091 predicted 995
10 SASI_Mm01_00051092 predicted 1961
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145073
USP27X MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 27, X-linked
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145073.1-855s21c1
Sequence:CCGGGTCTCCTCATGTGCCCTATAACTCGAGTTATAGGGCACATGAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145073.1-2017s21c1
Sequence:CCGGCACTGGTACATATCCTATATTCTCGAGAATATAGGATATGTACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145073.1-735s21c1
Sequence:CCGGCACGCCGATACTGAGAGATTTCTCGAGAAATCTCTCAGTATCGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145073.1-592s21c1
Sequence:CCGGGAAACAACCAAACCAGAATTACTCGAGTAATTCTGGTTTGGTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145073.1-652s21c1
Sequence:CCGGTCCAGCTTTACGATCGGTTTACTCGAGTAAACCGATCGTAAAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145073
USP27X MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 27, X-linked
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145073.1-855s21c1
Sequence:CCGGGTCTCCTCATGTGCCCTATAACTCGAGTTATAGGGCACATGAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145073.1-2017s21c1
Sequence:CCGGCACTGGTACATATCCTATATTCTCGAGAATATAGGATATGTACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145073.1-735s21c1
Sequence:CCGGCACGCCGATACTGAGAGATTTCTCGAGAAATCTCTCAGTATCGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145073.1-592s21c1
Sequence:CCGGGAAACAACCAAACCAGAATTACTCGAGTAATTCTGGTTTGGTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145073.1-652s21c1
Sequence:CCGGTCCAGCTTTACGATCGGTTTACTCGAGTAAACCGATCGTAAAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145073
USP27X MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 27, X-linked
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145073.1-855s21c1
Sequence:CCGGGTCTCCTCATGTGCCCTATAACTCGAGTTATAGGGCACATGAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145073.1-2017s21c1
Sequence:CCGGCACTGGTACATATCCTATATTCTCGAGAATATAGGATATGTACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145073.1-735s21c1
Sequence:CCGGCACGCCGATACTGAGAGATTTCTCGAGAAATCTCTCAGTATCGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145073.1-592s21c1
Sequence:CCGGGAAACAACCAAACCAGAATTACTCGAGTAATTCTGGTTTGGTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145073.1-652s21c1
Sequence:CCGGTCCAGCTTTACGATCGGTTTACTCGAGTAAACCGATCGTAAAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019461
USP27X MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 27, X-linked
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-2038s1c1
Sequence:CCGGGCGAACAACGAGAATAAGTATCTCGAGATACTTATTCTCGTTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-1962s1c1
Sequence:CCGGGCTGGATATGACACCATTTATCTCGAGATAAATGGTGTCATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-2025s1c1
Sequence:CCGGCCCAACCAATAGTGCGAACAACTCGAGTTGTTCGCACTATTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-732s1c1
Sequence:CCGGGCAGGAATTGCGGGTTATCTACTCGAGTAGATAACCCGCAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-937s1c1
Sequence:CCGGGATCTTTATTATGGAGGCATACTCGAGTATGCCTCCATAATAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019461
USP27X MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 27, X-linked
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-2038s1c1
Sequence:CCGGGCGAACAACGAGAATAAGTATCTCGAGATACTTATTCTCGTTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-1962s1c1
Sequence:CCGGGCTGGATATGACACCATTTATCTCGAGATAAATGGTGTCATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-2025s1c1
Sequence:CCGGCCCAACCAATAGTGCGAACAACTCGAGTTGTTCGCACTATTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-732s1c1
Sequence:CCGGGCAGGAATTGCGGGTTATCTACTCGAGTAGATAACCCGCAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-937s1c1
Sequence:CCGGGATCTTTATTATGGAGGCATACTCGAGTATGCCTCCATAATAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019461
USP27X MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 27, X-linked
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-2038s1c1
Sequence:CCGGGCGAACAACGAGAATAAGTATCTCGAGATACTTATTCTCGTTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-1962s1c1
Sequence:CCGGGCTGGATATGACACCATTTATCTCGAGATAAATGGTGTCATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-2025s1c1
Sequence:CCGGCCCAACCAATAGTGCGAACAACTCGAGTTGTTCGCACTATTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-732s1c1
Sequence:CCGGGCAGGAATTGCGGGTTATCTACTCGAGTAGATAACCCGCAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019461.1-937s1c1
Sequence:CCGGGATCTTTATTATGGAGGCATACTCGAGTATGCCTCCATAATAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks