EMAIL THIS PAGE TO A FRIEND

USP28

ubiquitin specific peptidase 28

UniProtKB ID: Q96RU2, B0YJC0, B0YJC1, Q9P213
Gene ID:
Human(57646) Summary: The ubiquitin-dependent protein degradation pathway is essential for proteolysis of intracellular proteins and peptides. Enzymes that remove ubiquitin from ubiquitin-conjugated peptides, like USP28, affect the fate and degradation of intracellular proteins and are essential for maintenance of cell-free ubiquitin pools (Valero et al., 2001).[supplied by OMIM, Mar 2008]
Mouse(235323) ubiquitin specific peptidase 28
Rat(315639) ubiquitin specific peptidase 28
Zebrafish(567050) ubiquitin specific peptidase 28
chicken(428246) ubiquitin specific peptidase 28
domestic cat(101097756) ubiquitin specific peptidase 28
dog(489400) ubiquitin specific peptidase 28
cow(508902) ubiquitin specific peptidase 28
sheep(101114463) ubiquitin specific peptidase 28
domestic guinea pig(100713115) ubiquitin specific peptidase 28
Domestic Rabbit(100346849) ubiquitin specific peptidase 28
naked mole-rat(101725327) ubiquitin specific peptidase 28
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020886 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175482 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175482 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175482 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020886 Rosetta Predictions human pricing
NM_001108144 Rosetta Predictions rat pricing
NM_175482 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077918 predicted 306
2 SASI_Hs01_00077919 predicted 1823
3 SASI_Hs02_00354195 predicted 1426
4 SASI_Hs02_00354196 predicted 3352
5 SASI_Hs01_00077921 predicted 352
6 SASI_Hs01_00077923 predicted 497
7 SASI_Hs01_00077925 predicted 2853
8 SASI_Hs02_00354197 predicted 1718
9 SASI_Hs02_00354198 predicted 2594
10 SASI_Hs01_00077926 predicted 1200
11 SASI_Hs01_00077920 predicted 983
12 SASI_Hs01_00077922 predicted 705
13 SASI_Hs01_00077924 predicted 222
14 SASI_Hs01_00077927 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235794 predicted 2575
2 SASI_Rn02_00235795 predicted 1155
3 SASI_Rn02_00235796 predicted 1927
4 SASI_Rn02_00235797 predicted 2093
5 SASI_Rn02_00235798 predicted 2672
6 SASI_Rn02_00235799 predicted 2380
7 SASI_Rn02_00235800 predicted 1527
8 SASI_Rn02_00235801 predicted 816
9 SASI_Rn02_00235802 predicted 1084
10 SASI_Rn02_00235803 predicted 3200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154649 predicted 2561
2 SASI_Mm01_00154650 predicted 2579
3 SASI_Mm02_00346396 predicted 475
4 SASI_Mm01_00154651 predicted 3160
5 SASI_Mm01_00154653 predicted 444
6 SASI_Mm01_00154654 predicted 3221
7 SASI_Mm01_00154655 predicted 1193
8 SASI_Mm01_00154656 predicted 2679
9 SASI_Mm01_00154657 predicted 3213
10 SASI_Mm01_00154658 predicted 2154
11 SASI_Mm01_00154652 predicted 2751
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020886
USP28 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 28
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020886.2-1236s21c1
Sequence:CCGGCAAGGAGCTTATTCGAAATAACTCGAGTTATTTCGAATAAGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020886.2-1724s21c1
Sequence:GTACCGGCAAGTACTACTCAGACTATTGCTCGAGCAATAGTCTGAGTAGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020886.2-3950s21c1
Sequence:GTACCGGGACTGAAGATCATCCATTAATCTCGAGATTAATGGATGATCTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020886.2-741s21c1
Sequence:CCGGTGCAGCCCTGGATCTATTAAACTCGAGTTTAATAGATCCAGGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020886.2-700s21c1
Sequence:CCGGGCTCTAATGATGGGATCAAATCTCGAGATTTGATCCCATCATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020886.2-3169s1c1
Sequence:CCGGCCTCCAACTATTCGACCCAATCTCGAGATTGGGTCGAATAGTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020886.2-3145s1c1
Sequence:CCGGGCAGAAATCATCGTCTTGAAACTCGAGTTTCAAGACGATGATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020886.2-2013s1c1
Sequence:CCGGCCCAACTGAATCAGATCAAATCTCGAGATTTGATCTGATTCAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020886.2-700s1c1
Sequence:CCGGGCTCTAATGATGGGATCAAATCTCGAGATTTGATCCCATCATTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020886.2-3316s1c1
Sequence:CCGGGCACAGAAGTTCGTTGTCATACTCGAGTATGACAACGAACTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020886
USP28 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 28
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020886.2-1236s21c1
Sequence:CCGGCAAGGAGCTTATTCGAAATAACTCGAGTTATTTCGAATAAGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020886.2-1724s21c1
Sequence:GTACCGGCAAGTACTACTCAGACTATTGCTCGAGCAATAGTCTGAGTAGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020886.2-3950s21c1
Sequence:GTACCGGGACTGAAGATCATCCATTAATCTCGAGATTAATGGATGATCTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020886.2-741s21c1
Sequence:CCGGTGCAGCCCTGGATCTATTAAACTCGAGTTTAATAGATCCAGGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020886.2-700s21c1
Sequence:CCGGGCTCTAATGATGGGATCAAATCTCGAGATTTGATCCCATCATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020886.2-3169s1c1
Sequence:CCGGCCTCCAACTATTCGACCCAATCTCGAGATTGGGTCGAATAGTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020886.2-3145s1c1
Sequence:CCGGGCAGAAATCATCGTCTTGAAACTCGAGTTTCAAGACGATGATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020886.2-2013s1c1
Sequence:CCGGCCCAACTGAATCAGATCAAATCTCGAGATTTGATCTGATTCAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020886.2-700s1c1
Sequence:CCGGGCTCTAATGATGGGATCAAATCTCGAGATTTGATCCCATCATTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020886.2-3316s1c1
Sequence:CCGGGCACAGAAGTTCGTTGTCATACTCGAGTATGACAACGAACTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020886
USP28 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 28
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020886.2-1236s21c1
Sequence:CCGGCAAGGAGCTTATTCGAAATAACTCGAGTTATTTCGAATAAGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020886.2-1724s21c1
Sequence:GTACCGGCAAGTACTACTCAGACTATTGCTCGAGCAATAGTCTGAGTAGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020886.2-3950s21c1
Sequence:GTACCGGGACTGAAGATCATCCATTAATCTCGAGATTAATGGATGATCTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020886.2-741s21c1
Sequence:CCGGTGCAGCCCTGGATCTATTAAACTCGAGTTTAATAGATCCAGGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020886.2-700s21c1
Sequence:CCGGGCTCTAATGATGGGATCAAATCTCGAGATTTGATCCCATCATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020886.2-3169s1c1
Sequence:CCGGCCTCCAACTATTCGACCCAATCTCGAGATTGGGTCGAATAGTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020886.2-3145s1c1
Sequence:CCGGGCAGAAATCATCGTCTTGAAACTCGAGTTTCAAGACGATGATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020886.2-2013s1c1
Sequence:CCGGCCCAACTGAATCAGATCAAATCTCGAGATTTGATCTGATTCAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020886.2-700s1c1
Sequence:CCGGGCTCTAATGATGGGATCAAATCTCGAGATTTGATCCCATCATTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020886.2-3316s1c1
Sequence:CCGGGCACAGAAGTTCGTTGTCATACTCGAGTATGACAACGAACTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175482
VALIDATED
USP28 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 28
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175482.3-763s1c1
Sequence:CCGGGCTCTGTTGTTGGGATCAAATCTCGAGATTTGATCCCAACAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175482.3-2148s1c1
Sequence:CCGGGCAGTACATTCAGGAAGATAACTCGAGTTATCTTCCTGAATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175482.3-1336s1c1
Sequence:CCGGCGGAAGTTGAAGGAGGAAATACTCGAGTATTTCCTCCTTCAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175482.3-3154s1c1
Sequence:CCGGCCTCCAACTATTCGACCGAATCTCGAGATTCGGTCGAATAGTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175482.3-619s1c1
Sequence:CCGGGCTGTTATTCAGTCTCTCTTTCTCGAGAAAGAGAGACTGAATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175482
VALIDATED
USP28 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 28
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175482.3-763s1c1
Sequence:CCGGGCTCTGTTGTTGGGATCAAATCTCGAGATTTGATCCCAACAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175482.3-2148s1c1
Sequence:CCGGGCAGTACATTCAGGAAGATAACTCGAGTTATCTTCCTGAATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175482.3-1336s1c1
Sequence:CCGGCGGAAGTTGAAGGAGGAAATACTCGAGTATTTCCTCCTTCAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175482.3-3154s1c1
Sequence:CCGGCCTCCAACTATTCGACCGAATCTCGAGATTCGGTCGAATAGTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175482.3-619s1c1
Sequence:CCGGGCTGTTATTCAGTCTCTCTTTCTCGAGAAAGAGAGACTGAATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175482
VALIDATED
USP28 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 28
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175482.3-763s1c1
Sequence:CCGGGCTCTGTTGTTGGGATCAAATCTCGAGATTTGATCCCAACAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175482.3-2148s1c1
Sequence:CCGGGCAGTACATTCAGGAAGATAACTCGAGTTATCTTCCTGAATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175482.3-1336s1c1
Sequence:CCGGCGGAAGTTGAAGGAGGAAATACTCGAGTATTTCCTCCTTCAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175482.3-3154s1c1
Sequence:CCGGCCTCCAACTATTCGACCGAATCTCGAGATTCGGTCGAATAGTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175482.3-619s1c1
Sequence:CCGGGCTGTTATTCAGTCTCTCTTTCTCGAGAAAGAGAGACTGAATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks