EMAIL THIS PAGE TO A FRIEND

USP29

ubiquitin specific peptidase 29

Synonyms: HOM-TES-84/86
UniProtKB ID: Q9HBJ7
Gene ID:
Mouse(57775) ubiquitin specific peptidase 29
Rat(361495) ubiquitin specific peptidase 29
sheep(101112508) ubiquitin specific peptidase 29
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020903 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021323 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021323 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021323 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020903 Rosetta Predictions human pricing
NM_001108465 Rosetta Predictions rat pricing
NM_021323 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032719 predicted 420
2 SASI_Hs01_00032720 predicted 1919
3 SASI_Hs01_00032721 predicted 1641
4 SASI_Hs01_00032722 predicted 2260
5 SASI_Hs01_00032723 predicted 2779
6 SASI_Hs02_00354238 predicted 425
7 SASI_Hs01_00032724 predicted 2648
8 SASI_Hs01_00032726 predicted 2857
9 SASI_Hs01_00032727 predicted 1606
10 SASI_Hs02_00354239 predicted 622
11 SASI_Hs01_00032725 predicted 2127
12 SASI_Hs01_00032728 predicted 2321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238909 predicted 1658
2 SASI_Rn02_00238910 predicted 1455
3 SASI_Rn02_00238911 predicted 900
4 SASI_Rn02_00238912 predicted 766
5 SASI_Rn02_00238913 predicted 804
6 SASI_Rn02_00238914 predicted 2497
7 SASI_Rn02_00238915 predicted 634
8 SASI_Rn02_00238916 predicted 1367
9 SASI_Rn02_00238917 predicted 1506
10 SASI_Rn02_00238918 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085114 predicted 1929
2 SASI_Mm01_00085115 predicted 1470
3 SASI_Mm01_00085116 predicted 3176
4 SASI_Mm01_00085117 predicted 2596
5 SASI_Mm01_00085118 predicted 3359
6 SASI_Mm02_00325878 predicted 1547
7 SASI_Mm01_00085119 predicted 2723
8 SASI_Mm01_00085121 predicted 3230
9 SASI_Mm01_00085123 predicted 3693
10 SASI_Mm02_00325879 predicted 3578
11 SASI_Mm01_00085120 predicted 3140
12 SASI_Mm01_00085122 predicted 3902
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020903
USP29 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 29
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020903.x-2333s1c1
Sequence:CCGGCCCTCAATCAGTCTACAGAATCTCGAGATTCTGTAGACTGATTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020903.x-3211s1c1
Sequence:CCGGTGTGTGGAGTATCTTGGTGTACTCGAGTACACCAAGATACTCCACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020903.x-1932s1c1
Sequence:CCGGCCACTTTAGAGATAGGGCAATCTCGAGATTGCCCTATCTCTAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020903.x-2238s1c1
Sequence:CCGGGCAGTGTATTGAGGAGAGCATCTCGAGATGCTCTCCTCAATACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020903.x-1597s1c1
Sequence:CCGGCTGGTGAAGAATAACGAGCAACTCGAGTTGCTCGTTATTCTTCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-559s21c1
Sequence:CCGGGACAAAGTCACCTGCGTTTAACTCGAGTTAAACGCAGGTGACTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-1150s21c1
Sequence:CCGGGTGACCCAAGATGCAACAAAGCTCGAGCTTTGTTGCATCTTGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-1859s21c1
Sequence:CCGGTAGGCTCTCCAGGGTCCTTATCTCGAGATAAGGACCCTGGAGAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-2150s21c1
Sequence:CCGGCAAGAATGCCGACCTACAAAGCTCGAGCTTTGTAGGTCGGCATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-1649s21c1
Sequence:CCGGATTGCAGCTCTCCCTTATTTGCTCGAGCAAATAAGGGAGAGCTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020903
USP29 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 29
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020903.x-2333s1c1
Sequence:CCGGCCCTCAATCAGTCTACAGAATCTCGAGATTCTGTAGACTGATTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020903.x-3211s1c1
Sequence:CCGGTGTGTGGAGTATCTTGGTGTACTCGAGTACACCAAGATACTCCACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020903.x-1932s1c1
Sequence:CCGGCCACTTTAGAGATAGGGCAATCTCGAGATTGCCCTATCTCTAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020903.x-2238s1c1
Sequence:CCGGGCAGTGTATTGAGGAGAGCATCTCGAGATGCTCTCCTCAATACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020903.x-1597s1c1
Sequence:CCGGCTGGTGAAGAATAACGAGCAACTCGAGTTGCTCGTTATTCTTCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-559s21c1
Sequence:CCGGGACAAAGTCACCTGCGTTTAACTCGAGTTAAACGCAGGTGACTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-1150s21c1
Sequence:CCGGGTGACCCAAGATGCAACAAAGCTCGAGCTTTGTTGCATCTTGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-1859s21c1
Sequence:CCGGTAGGCTCTCCAGGGTCCTTATCTCGAGATAAGGACCCTGGAGAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-2150s21c1
Sequence:CCGGCAAGAATGCCGACCTACAAAGCTCGAGCTTTGTAGGTCGGCATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-1649s21c1
Sequence:CCGGATTGCAGCTCTCCCTTATTTGCTCGAGCAAATAAGGGAGAGCTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020903
USP29 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 29
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020903.x-2333s1c1
Sequence:CCGGCCCTCAATCAGTCTACAGAATCTCGAGATTCTGTAGACTGATTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020903.x-3211s1c1
Sequence:CCGGTGTGTGGAGTATCTTGGTGTACTCGAGTACACCAAGATACTCCACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020903.x-1932s1c1
Sequence:CCGGCCACTTTAGAGATAGGGCAATCTCGAGATTGCCCTATCTCTAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020903.x-2238s1c1
Sequence:CCGGGCAGTGTATTGAGGAGAGCATCTCGAGATGCTCTCCTCAATACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020903.x-1597s1c1
Sequence:CCGGCTGGTGAAGAATAACGAGCAACTCGAGTTGCTCGTTATTCTTCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-559s21c1
Sequence:CCGGGACAAAGTCACCTGCGTTTAACTCGAGTTAAACGCAGGTGACTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-1150s21c1
Sequence:CCGGGTGACCCAAGATGCAACAAAGCTCGAGCTTTGTTGCATCTTGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-1859s21c1
Sequence:CCGGTAGGCTCTCCAGGGTCCTTATCTCGAGATAAGGACCCTGGAGAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-2150s21c1
Sequence:CCGGCAAGAATGCCGACCTACAAAGCTCGAGCTTTGTAGGTCGGCATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020903.2-1649s21c1
Sequence:CCGGATTGCAGCTCTCCCTTATTTGCTCGAGCAAATAAGGGAGAGCTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021323
USP29 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 29
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021323.1-6252s1c1
Sequence:CCGGCCCAGGTTCAATCCCTAGTATCTCGAGATACTAGGGATTGAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021323.1-3820s1c1
Sequence:CCGGCCATTATGTAAGTGATGTGTACTCGAGTACACATCACTTACATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021323.1-2032s1c1
Sequence:CCGGCGCAGAAGTGAACAAGGACATCTCGAGATGTCCTTGTTCACTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021323.1-3172s1c1
Sequence:CCGGCCAGTCAATGTCATCTAAGAACTCGAGTTCTTAGATGACATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021323.1-2320s1c1
Sequence:CCGGCCCTTACCTAAATCAACTAAACTCGAGTTTAGTTGATTTAGGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021323
USP29 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 29
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021323.1-6252s1c1
Sequence:CCGGCCCAGGTTCAATCCCTAGTATCTCGAGATACTAGGGATTGAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021323.1-3820s1c1
Sequence:CCGGCCATTATGTAAGTGATGTGTACTCGAGTACACATCACTTACATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021323.1-2032s1c1
Sequence:CCGGCGCAGAAGTGAACAAGGACATCTCGAGATGTCCTTGTTCACTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021323.1-3172s1c1
Sequence:CCGGCCAGTCAATGTCATCTAAGAACTCGAGTTCTTAGATGACATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021323.1-2320s1c1
Sequence:CCGGCCCTTACCTAAATCAACTAAACTCGAGTTTAGTTGATTTAGGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021323
USP29 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 29
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021323.1-6252s1c1
Sequence:CCGGCCCAGGTTCAATCCCTAGTATCTCGAGATACTAGGGATTGAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021323.1-3820s1c1
Sequence:CCGGCCATTATGTAAGTGATGTGTACTCGAGTACACATCACTTACATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021323.1-2032s1c1
Sequence:CCGGCGCAGAAGTGAACAAGGACATCTCGAGATGTCCTTGTTCACTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021323.1-3172s1c1
Sequence:CCGGCCAGTCAATGTCATCTAAGAACTCGAGTTCTTAGATGACATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021323.1-2320s1c1
Sequence:CCGGCCCTTACCTAAATCAACTAAACTCGAGTTTAGTTGATTTAGGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks