EMAIL THIS PAGE TO A FRIEND

USP2

ubiquitin specific peptidase 2

Synonyms: UBP41 USP9
UniProtKB ID: O75604, B0YJB8, Q8IUM2, Q8IW04, Q96MB9, Q9BQ21
Gene ID:
Human(9099) Summary: This gene encodes a member of the family of de-ubiquitinating enzymes, which belongs to the peptidase C19 superfamily. The encoded protein is a ubiquitin-specific protease which is required for TNF-alpha (tumor necrosis factor alpha) -induced NF-kB (nuclear factor kB) signaling. This protein deubiquitinates polyubiquitinated target proteins such as fatty acid synthase, murine double minute 2 (MDM2), MDM4/MDMX and cyclin D1. MDM2 and MDM4 are negative regulators of the p53 tumor suppressor and cyclin D1 is required for cell cycle G1/S transition. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Mouse(53376) ubiquitin specific peptidase 2
Rat(115771) ubiquitin specific peptidase 2
cow(522980) ubiquitin specific peptidase 2
sheep(101109478) ubiquitin specific peptidase 2
domestic guinea pig(100716929) ubiquitin specific peptidase 2
naked mole-rat(101712304) ubiquitin specific peptidase 2
chicken(395766) ubiquitin specific peptidase 2
domestic cat(101097757) ubiquitin specific peptidase 2
dog(608188) ubiquitin specific peptidase 2
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004205 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004205 Rosetta Predictions human pricing
NM_171997 Rosetta Predictions human pricing
NM_053774 Rosetta Predictions rat pricing
NM_016808 Rosetta Predictions mouse pricing
NM_198091 Rosetta Predictions mouse pricing
NM_198092 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149958 predicted 1429
2 SASI_Hs02_00337104 predicted 1854
3 SASI_Hs02_00337105 predicted 1828
4 SASI_Hs02_00337106 predicted 1947
5 SASI_Hs01_00149960 predicted 1562
6 SASI_Hs01_00149964 predicted 1437
7 SASI_Hs02_00337107 predicted 1673
8 SASI_Hs01_00149965 predicted 1323
9 SASI_Hs02_00337108 predicted 1621
10 SASI_Hs02_00337109 predicted 1608
11 SASI_Hs01_00149959 predicted 984
12 SASI_Hs01_00149961 predicted 693
13 SASI_Hs01_00149962 predicted 282
14 SASI_Hs01_00149963 predicted 1050
15 SASI_Hs01_00149966 predicted 1474
16 SASI_Hs01_00149967 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174976 predicted 691
2 SASI_Hs02_00367754 predicted 632
3 SASI_Hs01_00174980 predicted 823
4 SASI_Hs01_00174981 predicted 702
5 SASI_Hs01_00174982 predicted 709
6 SASI_Hs01_00174984 predicted 589
7 SASI_Hs02_00367755 predicted 628
8 SASI_Hs01_00174977 predicted 1121
9 SASI_Hs02_00367756 predicted 792
10 SASI_Hs02_00367757 predicted 897
11 SASI_Hs01_00174978 predicted 1098
12 SASI_Hs01_00174979 predicted 1135
13 SASI_Hs01_00174983 predicted 941
14 SASI_Hs01_00174985 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100511 predicted 1367
2 SASI_Rn02_00266573 predicted 1234
3 SASI_Rn02_00266574 predicted 1700
4 SASI_Rn01_00100514 predicted 627
5 SASI_Rn01_00100515 predicted 461
6 SASI_Rn02_00266575 predicted 1506
7 SASI_Rn01_00100516 predicted 744
8 SASI_Rn01_00100517 predicted 1081
9 SASI_Rn01_00100518 predicted 1742
10 SASI_Rn01_00100519 predicted 1727
11 SASI_Rn01_00100512 predicted 1516
12 SASI_Rn01_00100513 predicted 1538
13 SASI_Rn01_00100520 predicted 1678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111283 predicted 1725
2 SASI_Mm01_00111284 predicted 1537
3 SASI_Mm01_00111285 predicted 1557
4 SASI_Mm01_00111286 predicted 1455
5 SASI_Mm01_00111287 predicted 1833
6 SASI_Mm01_00111288 predicted 1754
7 SASI_Mm01_00111290 predicted 1576
8 SASI_Mm01_00111291 predicted 1336
9 SASI_Mm01_00111292 predicted 1232
10 SASI_Mm02_00323604 predicted 1763
11 SASI_Mm01_00111289 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027533 predicted 1175
2 SASI_Mm01_00027534 predicted 995
3 SASI_Mm01_00027535 predicted 1010
4 SASI_Mm01_00027536 predicted 914
5 SASI_Mm01_00027537 predicted 1287
6 SASI_Mm01_00027538 predicted 1208
7 SASI_Mm01_00027540 predicted 1036
8 SASI_Mm01_00027541 predicted 793
9 SASI_Mm01_00027542 predicted 686
10 SASI_Mm02_00350813 predicted 1219
11 SASI_Mm01_00027539 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157936 predicted 1824
2 SASI_Mm01_00157937 predicted 1636
3 SASI_Mm01_00157938 predicted 1648
4 SASI_Mm01_00157939 predicted 1557
5 SASI_Mm01_00157940 predicted 1932
6 SASI_Mm01_00157941 predicted 1844
7 SASI_Mm01_00157943 predicted 1674
8 SASI_Mm01_00157944 predicted 1434
9 SASI_Mm01_00157945 predicted 1326
10 SASI_Mm02_00350814 predicted 1859
11 SASI_Mm01_00157942 predicted 1326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016808
VALIDATED
USP2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016808.1-286s1c1
Sequence:CCGGCCACGCTTCATGGGCTATAATCTCGAGATTATAGCCCATGAAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016808.1-754s1c1
Sequence:CCGGCGATTCTCAGAATCCAGGATACTCGAGTATCCTGGATTCTGAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016808.1-786s1c1
Sequence:CCGGGCTCACAACATTTGTGAATTTCTCGAGAAATTCACAAATGTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016808.1-595s1c1
Sequence:CCGGCCTGAGGTGACGTTAATGGATCTCGAGATCCATTAACGTCACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016808.1-457s1c1
Sequence:CCGGGAAAGGGAAGACAGTCGGATTCTCGAGAATCCGACTGTCTTCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-1533s21c1
Sequence:CCGGTTACCCTGAGGTGACGTTAATCTCGAGATTAACGTCACCTCAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-1229s21c1
Sequence:CCGGCACGCTTCATGGGCTATAATCCTCGAGGATTATAGCCCATGAAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-394s21c1
Sequence:CCGGGACATCATTGGGAGTAGTAAGCTCGAGCTTACTACTCCCAATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016808.2-2173s21c1
Sequence:CCGGCTGCCGAGCAGAAGTTGATACCTCGAGGTATCAACTTCTGCTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-1047s21c1
Sequence:CCGGCACCCGAGAGCTGAGAGATTACTCGAGTAATCTCTCAGCTCTCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-1570s21c1
Sequence:CCGGTTCACCAAAGAGGACATATTGCTCGAGCAATATGTCCTCTTTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016808.2-2313s21c1
Sequence:CCGGTGGCTTCTCTCGTTTGCATTTCTCGAGAAATGCAAACGAGAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016808
VALIDATED
USP2 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016808.1-286s1c1
Sequence:CCGGCCACGCTTCATGGGCTATAATCTCGAGATTATAGCCCATGAAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016808.1-754s1c1
Sequence:CCGGCGATTCTCAGAATCCAGGATACTCGAGTATCCTGGATTCTGAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016808.1-786s1c1
Sequence:CCGGGCTCACAACATTTGTGAATTTCTCGAGAAATTCACAAATGTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016808.1-595s1c1
Sequence:CCGGCCTGAGGTGACGTTAATGGATCTCGAGATCCATTAACGTCACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016808.1-457s1c1
Sequence:CCGGGAAAGGGAAGACAGTCGGATTCTCGAGAATCCGACTGTCTTCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-1533s21c1
Sequence:CCGGTTACCCTGAGGTGACGTTAATCTCGAGATTAACGTCACCTCAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-1229s21c1
Sequence:CCGGCACGCTTCATGGGCTATAATCCTCGAGGATTATAGCCCATGAAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-394s21c1
Sequence:CCGGGACATCATTGGGAGTAGTAAGCTCGAGCTTACTACTCCCAATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016808.2-2173s21c1
Sequence:CCGGCTGCCGAGCAGAAGTTGATACCTCGAGGTATCAACTTCTGCTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-1047s21c1
Sequence:CCGGCACCCGAGAGCTGAGAGATTACTCGAGTAATCTCTCAGCTCTCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-1570s21c1
Sequence:CCGGTTCACCAAAGAGGACATATTGCTCGAGCAATATGTCCTCTTTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016808.2-2313s21c1
Sequence:CCGGTGGCTTCTCTCGTTTGCATTTCTCGAGAAATGCAAACGAGAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016808
VALIDATED
USP2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016808.1-286s1c1
Sequence:CCGGCCACGCTTCATGGGCTATAATCTCGAGATTATAGCCCATGAAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016808.1-754s1c1
Sequence:CCGGCGATTCTCAGAATCCAGGATACTCGAGTATCCTGGATTCTGAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016808.1-786s1c1
Sequence:CCGGGCTCACAACATTTGTGAATTTCTCGAGAAATTCACAAATGTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016808.1-595s1c1
Sequence:CCGGCCTGAGGTGACGTTAATGGATCTCGAGATCCATTAACGTCACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016808.1-457s1c1
Sequence:CCGGGAAAGGGAAGACAGTCGGATTCTCGAGAATCCGACTGTCTTCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-1533s21c1
Sequence:CCGGTTACCCTGAGGTGACGTTAATCTCGAGATTAACGTCACCTCAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-1229s21c1
Sequence:CCGGCACGCTTCATGGGCTATAATCCTCGAGGATTATAGCCCATGAAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-394s21c1
Sequence:CCGGGACATCATTGGGAGTAGTAAGCTCGAGCTTACTACTCCCAATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016808.2-2173s21c1
Sequence:CCGGCTGCCGAGCAGAAGTTGATACCTCGAGGTATCAACTTCTGCTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-1047s21c1
Sequence:CCGGCACCCGAGAGCTGAGAGATTACTCGAGTAATCTCTCAGCTCTCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016808.2-1570s21c1
Sequence:CCGGTTCACCAAAGAGGACATATTGCTCGAGCAATATGTCCTCTTTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016808.2-2313s21c1
Sequence:CCGGTGGCTTCTCTCGTTTGCATTTCTCGAGAAATGCAAACGAGAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004205
USP2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004205.3-2282s1c1
Sequence:CCGGCCTCGGCGTTTGCATTTGTAACTCGAGTTACAAATGCAAACGCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004205.3-1266s1c1
Sequence:CCGGCCGCGCTTTGTTGGCTATAATCTCGAGATTATAGCCAACAAAGCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004205.3-1835s1c1
Sequence:CCGGCCATGCTGTTTACAACCTGTACTCGAGTACAGGTTGTAAACAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004205.3-1554s1c1
Sequence:CCGGCCCATTGCTAAGCGAGGTTATCTCGAGATAACCTCGCTTAGCAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004205.3-1766s1c1
Sequence:CCGGGCTCACAACATTTGTGAACTTCTCGAGAAGTTCACAAATGTTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004205.4-2611s21c1
Sequence:CCGGACAGACGAAGGGACATCTTTGCTCGAGCAAAGATGTCCCTTCGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004205.4-2572s21c1
Sequence:CCGGATGAGCCAAGAGCCCTCTTCACTCGAGTGAAGAGGGCTCTTGGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004205.4-1994s21c1
Sequence:CCGGACAGGAGAATGGCACACTTTCCTCGAGGAAAGTGTGCCATTCTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004205.4-1861s21c1
Sequence:CCGGCCTAAGAGACCTGGACTTAAGCTCGAGCTTAAGTCCAGGTCTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004205.4-357s21c1
Sequence:CCGGACTATGCCAAGTCGGGCTATGCTCGAGCATAGCCCGACTTGGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004205.4-2198s21c1
Sequence:CCGGACAACACACAAACCTGACAAGCTCGAGCTTGTCAGGTTTGTGTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004205.4-1156s21c1
Sequence:CCGGCACTCGGGAGTTGAGAGATTACTCGAGTAATCTCTCAACTCCCGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004205.4-2379s21c1
Sequence:CCGGTGGTCTTCCTATGTGTCAGAACTCGAGTTCTGACACATAGGAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004205
USP2 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004205.3-2282s1c1
Sequence:CCGGCCTCGGCGTTTGCATTTGTAACTCGAGTTACAAATGCAAACGCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004205.3-1266s1c1
Sequence:CCGGCCGCGCTTTGTTGGCTATAATCTCGAGATTATAGCCAACAAAGCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004205.3-1835s1c1
Sequence:CCGGCCATGCTGTTTACAACCTGTACTCGAGTACAGGTTGTAAACAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004205.3-1554s1c1
Sequence:CCGGCCCATTGCTAAGCGAGGTTATCTCGAGATAACCTCGCTTAGCAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004205.3-1766s1c1
Sequence:CCGGGCTCACAACATTTGTGAACTTCTCGAGAAGTTCACAAATGTTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004205.4-2611s21c1
Sequence:CCGGACAGACGAAGGGACATCTTTGCTCGAGCAAAGATGTCCCTTCGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004205.4-2572s21c1
Sequence:CCGGATGAGCCAAGAGCCCTCTTCACTCGAGTGAAGAGGGCTCTTGGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004205.4-1994s21c1
Sequence:CCGGACAGGAGAATGGCACACTTTCCTCGAGGAAAGTGTGCCATTCTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004205.4-1861s21c1
Sequence:CCGGCCTAAGAGACCTGGACTTAAGCTCGAGCTTAAGTCCAGGTCTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004205.4-357s21c1
Sequence:CCGGACTATGCCAAGTCGGGCTATGCTCGAGCATAGCCCGACTTGGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004205.4-2198s21c1
Sequence:CCGGACAACACACAAACCTGACAAGCTCGAGCTTGTCAGGTTTGTGTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004205.4-1156s21c1
Sequence:CCGGCACTCGGGAGTTGAGAGATTACTCGAGTAATCTCTCAACTCCCGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004205.4-2379s21c1
Sequence:CCGGTGGTCTTCCTATGTGTCAGAACTCGAGTTCTGACACATAGGAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004205
USP2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004205.3-2282s1c1
Sequence:CCGGCCTCGGCGTTTGCATTTGTAACTCGAGTTACAAATGCAAACGCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004205.3-1266s1c1
Sequence:CCGGCCGCGCTTTGTTGGCTATAATCTCGAGATTATAGCCAACAAAGCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004205.3-1835s1c1
Sequence:CCGGCCATGCTGTTTACAACCTGTACTCGAGTACAGGTTGTAAACAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004205.3-1554s1c1
Sequence:CCGGCCCATTGCTAAGCGAGGTTATCTCGAGATAACCTCGCTTAGCAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004205.3-1766s1c1
Sequence:CCGGGCTCACAACATTTGTGAACTTCTCGAGAAGTTCACAAATGTTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004205.4-2611s21c1
Sequence:CCGGACAGACGAAGGGACATCTTTGCTCGAGCAAAGATGTCCCTTCGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004205.4-2572s21c1
Sequence:CCGGATGAGCCAAGAGCCCTCTTCACTCGAGTGAAGAGGGCTCTTGGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004205.4-1994s21c1
Sequence:CCGGACAGGAGAATGGCACACTTTCCTCGAGGAAAGTGTGCCATTCTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004205.4-1861s21c1
Sequence:CCGGCCTAAGAGACCTGGACTTAAGCTCGAGCTTAAGTCCAGGTCTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004205.4-357s21c1
Sequence:CCGGACTATGCCAAGTCGGGCTATGCTCGAGCATAGCCCGACTTGGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004205.4-2198s21c1
Sequence:CCGGACAACACACAAACCTGACAAGCTCGAGCTTGTCAGGTTTGTGTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004205.4-1156s21c1
Sequence:CCGGCACTCGGGAGTTGAGAGATTACTCGAGTAATCTCTCAACTCCCGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004205.4-2379s21c1
Sequence:CCGGTGGTCTTCCTATGTGTCAGAACTCGAGTTCTGACACATAGGAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks