EMAIL THIS PAGE TO A FRIEND

USP30

ubiquitin specific peptidase 30

UniProtKB ID: Q70CQ3, Q8WTU7, Q96JX4, Q9BSS3
Gene ID:
Human(84749) Summary: USP30, a member of the ubiquitin-specific protease family (see USP1, MIM 603478), is a novel mitochondrial deubiquitinating (DUB) enzyme (Nakamura and Hirose, 2008 [PubMed 18287522]
Mouse(100756) ubiquitin specific peptidase 30
Rat(304579) ubiquitin specific peptidase 30
Zebrafish(559099) ubiquitin specific peptidase 30
domestic cat(101087177) ubiquitin specific peptidase 30
dog(611662) ubiquitin specific peptidase 30
chicken(416896) ubiquitin specific peptidase 30
naked mole-rat(101715886) ubiquitin specific peptidase 30
Domestic Rabbit(100339118) ubiquitin specific peptidase 30
domestic guinea pig(100733919) ubiquitin specific peptidase 30
cow(100140210) ubiquitin specific peptidase 30
sheep(101123665) ubiquitin specific peptidase 30
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_149655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_149655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_149655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032663 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032663 Rosetta Predictions human pricing
NM_001107153 Rosetta Predictions rat pricing
NM_001033202 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155679 predicted 581
2 SASI_Hs01_00155680 predicted 1190
3 SASI_Hs01_00155681 predicted 787
4 SASI_Hs02_00360211 predicted 584
5 SASI_Hs01_00155682 predicted 499
6 SASI_Hs01_00155683 predicted 613
7 SASI_Hs01_00155684 predicted 1433
8 SASI_Hs01_00155685 predicted 1380
9 SASI_Hs01_00155686 predicted 831
10 SASI_Hs01_00155687 predicted 768
11 SASI_Hs01_00155688 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226025 predicted 803
2 SASI_Rn02_00226026 predicted 877
3 SASI_Rn02_00226027 predicted 1039
4 SASI_Rn02_00226028 predicted 699
5 SASI_Rn02_00226029 predicted 1414
6 SASI_Rn02_00226030 predicted 1458
7 SASI_Rn02_00226031 predicted 721
8 SASI_Rn02_00226032 predicted 861
9 SASI_Rn02_00226033 predicted 1398
10 SASI_Rn02_00226034 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046194 predicted 1394
2 SASI_Mm01_00046195 predicted 785
3 SASI_Mm01_00046196 predicted 912
4 SASI_Mm02_00288325 predicted 1632
5 SASI_Mm01_00046197 predicted 1630
6 SASI_Mm01_00046198 predicted 1015
7 SASI_Mm01_00046199 predicted 1628
8 SASI_Mm01_00046201 predicted 1501
9 SASI_Mm01_00046202 predicted 462
10 SASI_Mm01_00046203 predicted 771
11 SASI_Mm01_00046200 predicted 1749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_149655
VALIDATED
USP30 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 30
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149655.4-834s1c1
Sequence:CCGGCACCAGTAACATGGTGTGCAACTCGAGTTGCACACCATGTTACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149655.4-1067s1c1
Sequence:CCGGGCACCTTTGTTAAACAGTTAACTCGAGTTAACTGTTTAACAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149655.4-1559s1c1
Sequence:CCGGGCAACCAATGGCTGTGGATTTCTCGAGAAATCCACAGCCATTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149655.4-1194s1c1
Sequence:CCGGCCTGATGATGGACTTCTACAACTCGAGTTGTAGAAGTCCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149655.4-874s1c1
Sequence:CCGGCCTGTTCGGTTTGACACCTTTCTCGAGAAAGGTGTCAAACCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_149655
VALIDATED
USP30 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 30
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149655.4-834s1c1
Sequence:CCGGCACCAGTAACATGGTGTGCAACTCGAGTTGCACACCATGTTACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149655.4-1067s1c1
Sequence:CCGGGCACCTTTGTTAAACAGTTAACTCGAGTTAACTGTTTAACAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149655.4-1559s1c1
Sequence:CCGGGCAACCAATGGCTGTGGATTTCTCGAGAAATCCACAGCCATTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149655.4-1194s1c1
Sequence:CCGGCCTGATGATGGACTTCTACAACTCGAGTTGTAGAAGTCCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149655.4-874s1c1
Sequence:CCGGCCTGTTCGGTTTGACACCTTTCTCGAGAAAGGTGTCAAACCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_149655
VALIDATED
USP30 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 30
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149655.4-834s1c1
Sequence:CCGGCACCAGTAACATGGTGTGCAACTCGAGTTGCACACCATGTTACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149655.4-1067s1c1
Sequence:CCGGGCACCTTTGTTAAACAGTTAACTCGAGTTAACTGTTTAACAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149655.4-1559s1c1
Sequence:CCGGGCAACCAATGGCTGTGGATTTCTCGAGAAATCCACAGCCATTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149655.4-1194s1c1
Sequence:CCGGCCTGATGATGGACTTCTACAACTCGAGTTGTAGAAGTCCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149655.4-874s1c1
Sequence:CCGGCCTGTTCGGTTTGACACCTTTCTCGAGAAAGGTGTCAAACCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032663
VALIDATED
USP30 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 30
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032663.2-1860s1c1
Sequence:CCGGCTGTTGTGTTAAGAAAGCATTCTCGAGAATGCTTTCTTAACACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032663.2-597s1c1
Sequence:CCGGCCATGTCATTACCTCGTCATTCTCGAGAATGACGAGGTAATGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032663.2-434s1c1
Sequence:CCGGCACACCAGTATTTATCCTTAACTCGAGTTAAGGATAAATACTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032663.2-823s1c1
Sequence:CCGGCCTGTTCGATTTGATACCTTTCTCGAGAAAGGTATCAAATCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032663.2-1186s1c1
Sequence:CCGGCCTAGTCAACACAACCCTAAACTCGAGTTTAGGGTTGTGTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-2036s21c1
Sequence:CCGGTTTAATAAGCAGGCCCATAAACTCGAGTTTATGGGCCTGCTTATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-849s21c1
Sequence:CCGGGATAGCCTTTCACTAAGTATTCTCGAGAATACTTAGTGAAAGGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032663.3-602s21c1
Sequence:CCGGCCATGTCATTACCTCGTCATTCTCGAGAATGACGAGGTAATGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-579s21c1
Sequence:CCGGGAACAGGATGCTCACGAATTACTCGAGTAATTCGTGAGCATCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-1910s21c1
Sequence:CCGGCTCATCTGATACAGGTAATTACTCGAGTAATTACCTGTATCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032663.3-1191s21c1
Sequence:CCGGCCTAGTCAACACAACCCTAAACTCGAGTTTAGGGTTGTGTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-234s21c1
Sequence:CCGGGCTCTTGCAGCAGGAATATATCTCGAGATATATTCCTGCTGCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032663
VALIDATED
USP30 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 30
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032663.2-1860s1c1
Sequence:CCGGCTGTTGTGTTAAGAAAGCATTCTCGAGAATGCTTTCTTAACACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032663.2-597s1c1
Sequence:CCGGCCATGTCATTACCTCGTCATTCTCGAGAATGACGAGGTAATGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032663.2-434s1c1
Sequence:CCGGCACACCAGTATTTATCCTTAACTCGAGTTAAGGATAAATACTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032663.2-823s1c1
Sequence:CCGGCCTGTTCGATTTGATACCTTTCTCGAGAAAGGTATCAAATCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032663.2-1186s1c1
Sequence:CCGGCCTAGTCAACACAACCCTAAACTCGAGTTTAGGGTTGTGTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-2036s21c1
Sequence:CCGGTTTAATAAGCAGGCCCATAAACTCGAGTTTATGGGCCTGCTTATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-849s21c1
Sequence:CCGGGATAGCCTTTCACTAAGTATTCTCGAGAATACTTAGTGAAAGGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032663.3-602s21c1
Sequence:CCGGCCATGTCATTACCTCGTCATTCTCGAGAATGACGAGGTAATGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-579s21c1
Sequence:CCGGGAACAGGATGCTCACGAATTACTCGAGTAATTCGTGAGCATCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-1910s21c1
Sequence:CCGGCTCATCTGATACAGGTAATTACTCGAGTAATTACCTGTATCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032663.3-1191s21c1
Sequence:CCGGCCTAGTCAACACAACCCTAAACTCGAGTTTAGGGTTGTGTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-234s21c1
Sequence:CCGGGCTCTTGCAGCAGGAATATATCTCGAGATATATTCCTGCTGCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032663
VALIDATED
USP30 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 30
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032663.2-1860s1c1
Sequence:CCGGCTGTTGTGTTAAGAAAGCATTCTCGAGAATGCTTTCTTAACACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032663.2-597s1c1
Sequence:CCGGCCATGTCATTACCTCGTCATTCTCGAGAATGACGAGGTAATGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032663.2-434s1c1
Sequence:CCGGCACACCAGTATTTATCCTTAACTCGAGTTAAGGATAAATACTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032663.2-823s1c1
Sequence:CCGGCCTGTTCGATTTGATACCTTTCTCGAGAAAGGTATCAAATCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032663.2-1186s1c1
Sequence:CCGGCCTAGTCAACACAACCCTAAACTCGAGTTTAGGGTTGTGTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-2036s21c1
Sequence:CCGGTTTAATAAGCAGGCCCATAAACTCGAGTTTATGGGCCTGCTTATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-849s21c1
Sequence:CCGGGATAGCCTTTCACTAAGTATTCTCGAGAATACTTAGTGAAAGGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032663.3-602s21c1
Sequence:CCGGCCATGTCATTACCTCGTCATTCTCGAGAATGACGAGGTAATGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-579s21c1
Sequence:CCGGGAACAGGATGCTCACGAATTACTCGAGTAATTCGTGAGCATCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-1910s21c1
Sequence:CCGGCTCATCTGATACAGGTAATTACTCGAGTAATTACCTGTATCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032663.3-1191s21c1
Sequence:CCGGCCTAGTCAACACAACCCTAAACTCGAGTTTAGGGTTGTGTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_032663.3-234s21c1
Sequence:CCGGGCTCTTGCAGCAGGAATATATCTCGAGATATATTCCTGCTGCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks