EMAIL THIS PAGE TO A FRIEND

USP31

ubiquitin specific peptidase 31

UniProtKB ID: Q70CQ4, Q6AW97, Q6ZTC0, Q6ZTN2, Q9ULL7
Gene ID:
Mouse(76179) ubiquitin specific peptidase 31
Rat(308959) ubiquitin specific peptidase 31
Zebrafish(564487) ubiquitin specific peptidase 31
chicken(416580) ubiquitin specific peptidase 31
domestic cat(101090478) ubiquitin specific peptidase 31
dog(489974) ubiquitin specific peptidase 48
cow(786875) ubiquitin specific peptidase 48
sheep(101116625) ubiquitin specific peptidase 31
domestic guinea pig(100715744) ubiquitin specific peptidase 31
naked mole-rat(101716181) ubiquitin specific peptidase 31
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020718 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_357781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_357781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_357781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020718 Rosetta Predictions human pricing
NM_001107548 Rosetta Predictions rat pricing
XM_357781 Rosetta Predictions mouse pricing
XM_992065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020641 predicted 1511
2 SASI_Hs01_00020642 predicted 3141
3 SASI_Hs01_00020643 predicted 2104
4 SASI_Hs01_00020644 predicted 1244
5 SASI_Hs01_00020645 predicted 1180
6 SASI_Hs01_00020646 predicted 2005
7 SASI_Hs02_00353745 predicted 1730
8 SASI_Hs01_00020648 predicted 3472
9 SASI_Hs01_00020650 predicted 848
10 SASI_Hs02_00353746 predicted 3628
11 SASI_Hs01_00020647 predicted 2891
12 SASI_Hs01_00020649 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229915 predicted 3270
2 SASI_Rn02_00229916 predicted 1471
3 SASI_Rn02_00229917 predicted 728
4 SASI_Rn02_00229918 predicted 614
5 SASI_Rn02_00229919 predicted 1051
6 SASI_Rn02_00229920 predicted 485
7 SASI_Rn02_00229921 predicted 3023
8 SASI_Rn02_00229922 predicted 459
9 SASI_Rn02_00229923 predicted 212
10 SASI_Rn02_00229924 predicted 3264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248651 predicted 3878
2 SASI_Mm01_00248652 predicted 1232
3 SASI_Mm02_00426174 predicted 2088
4 SASI_Mm01_00248653 predicted 1497
5 SASI_Mm01_00248654 predicted 3854
6 SASI_Mm01_00248657 predicted 1101
7 SASI_Mm01_00248658 predicted 3637
8 SASI_Mm01_00248659 predicted 1068
9 SASI_Mm01_00248660 predicted 1665
10 SASI_Mm02_00426175 predicted 833
11 SASI_Mm01_00248655 predicted 3171
12 SASI_Mm01_00248656 predicted 1947
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00450970 predicted 3880
2 SASI_Mm02_00450971 predicted 1227
3 SASI_Mm02_00450972 predicted 2083
4 SASI_Mm02_00450973 predicted 1500
5 SASI_Mm02_00450974 predicted 3859
6 SASI_Mm02_00450975 predicted 1102
7 SASI_Mm02_00450976 predicted 3632
8 SASI_Mm02_00450977 predicted 1064
9 SASI_Mm02_00450978 predicted 1665
10 SASI_Mm02_00450979 predicted 834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020718
VALIDATED
USP31 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 31
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020718.3-1269s21c1
Sequence:CCGGATTTGGCTTGGATTATCATAGCTCGAGCTATGATAATCCAAGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020718.3-4228s21c1
Sequence:CCGGTGTTCAAAGCGTCGCCTTATTCTCGAGAATAAGGCGACGCTTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020718.3-620s21c1
Sequence:CCGGGCCGCGACTTCAAGACTATTGCTCGAGCAATAGTCTTGAAGTCGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020718.3-1184s21c1
Sequence:CCGGCCTTTGAGACTCCCGAAATATCTCGAGATATTTCGGGAGTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020718.3-2265s21c1
Sequence:CCGGGACAGCATACATCCTCTTCTACTCGAGTAGAAGAGGATGTATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020718.x-1949s1c1
Sequence:CCGGGACAGCATACATCCTCTTCTACTCGAGTAGAAGAGGATGTATGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020718.x-2311s1c1
Sequence:CCGGGCTCCAATTCTCCATCCCGATCTCGAGATCGGGATGGAGAATTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020718.x-1591s1c1
Sequence:CCGGCTCTGCCTGATGTGCTTATTACTCGAGTAATAAGCACATCAGGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020718.x-3453s1c1
Sequence:CCGGGCTCTGTTAAGTCTGTCTGTACTCGAGTACAGACAGACTTAACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020718.x-652s1c1
Sequence:CCGGCTGTAGTGTATCAAGGCAAATCTCGAGATTTGCCTTGATACACTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020718
VALIDATED
USP31 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 31
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020718.3-1269s21c1
Sequence:CCGGATTTGGCTTGGATTATCATAGCTCGAGCTATGATAATCCAAGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020718.3-4228s21c1
Sequence:CCGGTGTTCAAAGCGTCGCCTTATTCTCGAGAATAAGGCGACGCTTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020718.3-620s21c1
Sequence:CCGGGCCGCGACTTCAAGACTATTGCTCGAGCAATAGTCTTGAAGTCGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020718.3-1184s21c1
Sequence:CCGGCCTTTGAGACTCCCGAAATATCTCGAGATATTTCGGGAGTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020718.3-2265s21c1
Sequence:CCGGGACAGCATACATCCTCTTCTACTCGAGTAGAAGAGGATGTATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020718.x-1949s1c1
Sequence:CCGGGACAGCATACATCCTCTTCTACTCGAGTAGAAGAGGATGTATGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020718.x-2311s1c1
Sequence:CCGGGCTCCAATTCTCCATCCCGATCTCGAGATCGGGATGGAGAATTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020718.x-1591s1c1
Sequence:CCGGCTCTGCCTGATGTGCTTATTACTCGAGTAATAAGCACATCAGGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020718.x-3453s1c1
Sequence:CCGGGCTCTGTTAAGTCTGTCTGTACTCGAGTACAGACAGACTTAACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020718.x-652s1c1
Sequence:CCGGCTGTAGTGTATCAAGGCAAATCTCGAGATTTGCCTTGATACACTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020718
VALIDATED
USP31 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 31
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020718.3-1269s21c1
Sequence:CCGGATTTGGCTTGGATTATCATAGCTCGAGCTATGATAATCCAAGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020718.3-4228s21c1
Sequence:CCGGTGTTCAAAGCGTCGCCTTATTCTCGAGAATAAGGCGACGCTTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020718.3-620s21c1
Sequence:CCGGGCCGCGACTTCAAGACTATTGCTCGAGCAATAGTCTTGAAGTCGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020718.3-1184s21c1
Sequence:CCGGCCTTTGAGACTCCCGAAATATCTCGAGATATTTCGGGAGTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020718.3-2265s21c1
Sequence:CCGGGACAGCATACATCCTCTTCTACTCGAGTAGAAGAGGATGTATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020718.x-1949s1c1
Sequence:CCGGGACAGCATACATCCTCTTCTACTCGAGTAGAAGAGGATGTATGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020718.x-2311s1c1
Sequence:CCGGGCTCCAATTCTCCATCCCGATCTCGAGATCGGGATGGAGAATTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020718.x-1591s1c1
Sequence:CCGGCTCTGCCTGATGTGCTTATTACTCGAGTAATAAGCACATCAGGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020718.x-3453s1c1
Sequence:CCGGGCTCTGTTAAGTCTGTCTGTACTCGAGTACAGACAGACTTAACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020718.x-652s1c1
Sequence:CCGGCTGTAGTGTATCAAGGCAAATCTCGAGATTTGCCTTGATACACTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_357781
VALIDATED
USP31 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 31
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357781.2-4612s1c1
Sequence:CCGGGCGCGATGAATTGGTAATGTTCTCGAGAACATTACCAATTCATCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357781.2-1250s1c1
Sequence:CCGGCCTTTACTTATTCCTCCTCATCTCGAGATGAGGAGGAATAAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357781.2-1790s1c1
Sequence:CCGGCTGCTAAACATTCCTTGCTATCTCGAGATAGCAAGGAATGTTTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357781.2-773s1c1
Sequence:CCGGCCAGTGTTGTAGACACACCAACTCGAGTTGGTGTGTCTACAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357781.2-1037s1c1
Sequence:CCGGGCCAGGAATCTTCTCTGTCAACTCGAGTTGACAGAGAAGATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_357781
VALIDATED
USP31 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 31
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357781.2-4612s1c1
Sequence:CCGGGCGCGATGAATTGGTAATGTTCTCGAGAACATTACCAATTCATCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357781.2-1250s1c1
Sequence:CCGGCCTTTACTTATTCCTCCTCATCTCGAGATGAGGAGGAATAAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357781.2-1790s1c1
Sequence:CCGGCTGCTAAACATTCCTTGCTATCTCGAGATAGCAAGGAATGTTTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357781.2-773s1c1
Sequence:CCGGCCAGTGTTGTAGACACACCAACTCGAGTTGGTGTGTCTACAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357781.2-1037s1c1
Sequence:CCGGGCCAGGAATCTTCTCTGTCAACTCGAGTTGACAGAGAAGATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_357781
VALIDATED
USP31 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 31
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357781.2-4612s1c1
Sequence:CCGGGCGCGATGAATTGGTAATGTTCTCGAGAACATTACCAATTCATCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357781.2-1250s1c1
Sequence:CCGGCCTTTACTTATTCCTCCTCATCTCGAGATGAGGAGGAATAAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357781.2-1790s1c1
Sequence:CCGGCTGCTAAACATTCCTTGCTATCTCGAGATAGCAAGGAATGTTTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357781.2-773s1c1
Sequence:CCGGCCAGTGTTGTAGACACACCAACTCGAGTTGGTGTGTCTACAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357781.2-1037s1c1
Sequence:CCGGGCCAGGAATCTTCTCTGTCAACTCGAGTTGACAGAGAAGATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks