EMAIL THIS PAGE TO A FRIEND

USP32

ubiquitin specific peptidase 32

Synonyms: NY-REN-60 USP10
UniProtKB ID: Q8NFA0, Q9BX85, Q9Y591
Gene ID:
Mouse(237898) ubiquitin specific peptidase 32
Rat(303394) ubiquitin specific peptidase 32
naked mole-rat(101699824) ubiquitin specific peptidase 32
Domestic Rabbit(100357516) ubiquitin specific peptidase 32
domestic guinea pig(100730914) ubiquitin specific peptidase 32
cow(537257) ubiquitin specific peptidase 32
sheep(101109460) ubiquitin specific peptidase 32
Zebrafish(557981) ubiquitin specific peptidase 32
chicken(417646) ubiquitin specific peptidase 32
Horse(100071369) ubiquitin specific peptidase 32
domestic cat(101088794) ubiquitin specific peptidase 32
dog(480590) ubiquitin specific peptidase 32
180 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA044365 Anti-USP32 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503380 Anti-USP32 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_110937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_110937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_110937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032582 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032582 Rosetta Predictions human pricing
NM_001107032 Rosetta Predictions rat pricing
NM_001029934 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086230 predicted 1851
2 SASI_Hs01_00086231 predicted 604
3 SASI_Hs01_00086232 predicted 2306
4 SASI_Hs01_00086233 predicted 1038
5 SASI_Hs01_00086234 predicted 1218
6 SASI_Hs01_00086235 predicted 2127
7 SASI_Hs01_00086236 predicted 2369
8 SASI_Hs01_00086238 predicted 1767
9 SASI_Hs01_00086239 predicted 1105
10 SASI_Hs02_00360114 predicted 2277
11 SASI_Hs01_00086237 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224816 predicted 1295
2 SASI_Rn02_00224817 predicted 3309
3 SASI_Rn02_00224818 predicted 1035
4 SASI_Rn02_00224819 predicted 2179
5 SASI_Rn02_00224820 predicted 1647
6 SASI_Rn02_00224821 predicted 2230
7 SASI_Rn02_00224822 predicted 2240
8 SASI_Rn02_00224823 predicted 377
9 SASI_Rn02_00224824 predicted 1395
10 SASI_Rn02_00224825 predicted 3938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288055 predicted 1808
2 SASI_Mm02_00288056 predicted 3942
3 SASI_Mm02_00288057 predicted 1529
4 SASI_Mm02_00288058 predicted 3766
5 SASI_Mm02_00288059 predicted 2863
6 SASI_Mm02_00288060 predicted 831
7 SASI_Mm02_00288061 predicted 4013
8 SASI_Mm02_00288062 predicted 2276
9 SASI_Mm02_00288063 predicted 2871
10 SASI_Mm02_00288064 predicted 1918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_110937
VALIDATED
USP32 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 32
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110937.4-3972s1c1
Sequence:CCGGCCCAACTCTTTGCCAGCATAACTCGAGTTATGCTGGCAAAGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110937.4-1639s1c1
Sequence:CCGGCCAGTAATCAAGAATAGCAAACTCGAGTTTGCTATTCTTGATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110937.4-1371s1c1
Sequence:CCGGGCAGCATAACACTTCTGACAACTCGAGTTGTCAGAAGTGTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110937.4-3644s1c1
Sequence:CCGGGCTATCAAACATCACAGGAAACTCGAGTTTCCTGTGATGTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110937.4-3044s1c1
Sequence:CCGGGCAGTCCAATTCAAACAGATTCTCGAGAATCTGTTTGAATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_110937
VALIDATED
USP32 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 32
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110937.4-3972s1c1
Sequence:CCGGCCCAACTCTTTGCCAGCATAACTCGAGTTATGCTGGCAAAGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110937.4-1639s1c1
Sequence:CCGGCCAGTAATCAAGAATAGCAAACTCGAGTTTGCTATTCTTGATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110937.4-1371s1c1
Sequence:CCGGGCAGCATAACACTTCTGACAACTCGAGTTGTCAGAAGTGTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110937.4-3644s1c1
Sequence:CCGGGCTATCAAACATCACAGGAAACTCGAGTTTCCTGTGATGTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110937.4-3044s1c1
Sequence:CCGGGCAGTCCAATTCAAACAGATTCTCGAGAATCTGTTTGAATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_110937
VALIDATED
USP32 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 32
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110937.4-3972s1c1
Sequence:CCGGCCCAACTCTTTGCCAGCATAACTCGAGTTATGCTGGCAAAGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110937.4-1639s1c1
Sequence:CCGGCCAGTAATCAAGAATAGCAAACTCGAGTTTGCTATTCTTGATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110937.4-1371s1c1
Sequence:CCGGGCAGCATAACACTTCTGACAACTCGAGTTGTCAGAAGTGTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110937.4-3644s1c1
Sequence:CCGGGCTATCAAACATCACAGGAAACTCGAGTTTCCTGTGATGTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110937.4-3044s1c1
Sequence:CCGGGCAGTCCAATTCAAACAGATTCTCGAGAATCTGTTTGAATTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032582
VALIDATED
USP32 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 32
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011131    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032582.2-848s1c1
Sequence:CCGGCCACCTATTCGTCCATCTCTACTCGAGTAGAGATGGACGAATAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011128    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_032582.2-1531s1c1
Sequence:CCGGCGTGAATACTACAGAAGAGAACTCGAGTTCTCTTCTGTAGTATTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011129    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_032582.2-3608s1c1
Sequence:CCGGGACGACAGTATGGGCTATCAACTCGAGTTGATAGCCCATACTGTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011127    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_032582.2-1083s1c1
Sequence:CCGGGCACTGATGATATTCCTGAATCTCGAGATTCAGGAATATCATCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011130    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_032582.2-2176s1c1
Sequence:CCGGGTGGCTATACAACAGTGAGAACTCGAGTTCTCACTGTTGTATAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-2060s21c1
Sequence:CCGGATCCCAGAGCTGGAATTATTTCTCGAGAAATAATTCCAGCTCTGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032582.3-5298s21c1
Sequence:CCGGGCTCTCCGATAGAGAACTTTCCTCGAGGAAAGTTCTCTATCGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-4550s21c1
Sequence:CCGGAGTAGTAAAGAGAACTTGGATCTCGAGATCCAAGTTCTCTTTACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-4787s21c1
Sequence:CCGGAGAGAAGATACTCGTATTAAGCTCGAGCTTAATACGAGTATCTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-4112s21c1
Sequence:CCGGCCCATCCTGATTATTCACCTTCTCGAGAAGGTGAATAATCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-3711s21c1
Sequence:CCGGCCCAGGATTGTGACGACAGTACTCGAGTACTGTCGTCACAATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-4147s21c1
Sequence:CCGGTGTAAATGGTCGGTGGATAAACTCGAGTTTATCCACCGACCATTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032582
VALIDATED
USP32 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 32
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011131    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032582.2-848s1c1
Sequence:CCGGCCACCTATTCGTCCATCTCTACTCGAGTAGAGATGGACGAATAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011128    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_032582.2-1531s1c1
Sequence:CCGGCGTGAATACTACAGAAGAGAACTCGAGTTCTCTTCTGTAGTATTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011129    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_032582.2-3608s1c1
Sequence:CCGGGACGACAGTATGGGCTATCAACTCGAGTTGATAGCCCATACTGTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011127    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_032582.2-1083s1c1
Sequence:CCGGGCACTGATGATATTCCTGAATCTCGAGATTCAGGAATATCATCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011130    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_032582.2-2176s1c1
Sequence:CCGGGTGGCTATACAACAGTGAGAACTCGAGTTCTCACTGTTGTATAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-2060s21c1
Sequence:CCGGATCCCAGAGCTGGAATTATTTCTCGAGAAATAATTCCAGCTCTGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032582.3-5298s21c1
Sequence:CCGGGCTCTCCGATAGAGAACTTTCCTCGAGGAAAGTTCTCTATCGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-4550s21c1
Sequence:CCGGAGTAGTAAAGAGAACTTGGATCTCGAGATCCAAGTTCTCTTTACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-4787s21c1
Sequence:CCGGAGAGAAGATACTCGTATTAAGCTCGAGCTTAATACGAGTATCTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-4112s21c1
Sequence:CCGGCCCATCCTGATTATTCACCTTCTCGAGAAGGTGAATAATCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-3711s21c1
Sequence:CCGGCCCAGGATTGTGACGACAGTACTCGAGTACTGTCGTCACAATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-4147s21c1
Sequence:CCGGTGTAAATGGTCGGTGGATAAACTCGAGTTTATCCACCGACCATTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032582
VALIDATED
USP32 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 32
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011131    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032582.2-848s1c1
Sequence:CCGGCCACCTATTCGTCCATCTCTACTCGAGTAGAGATGGACGAATAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011128    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_032582.2-1531s1c1
Sequence:CCGGCGTGAATACTACAGAAGAGAACTCGAGTTCTCTTCTGTAGTATTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011129    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_032582.2-3608s1c1
Sequence:CCGGGACGACAGTATGGGCTATCAACTCGAGTTGATAGCCCATACTGTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011127    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_032582.2-1083s1c1
Sequence:CCGGGCACTGATGATATTCCTGAATCTCGAGATTCAGGAATATCATCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011130    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_032582.2-2176s1c1
Sequence:CCGGGTGGCTATACAACAGTGAGAACTCGAGTTCTCACTGTTGTATAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-2060s21c1
Sequence:CCGGATCCCAGAGCTGGAATTATTTCTCGAGAAATAATTCCAGCTCTGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032582.3-5298s21c1
Sequence:CCGGGCTCTCCGATAGAGAACTTTCCTCGAGGAAAGTTCTCTATCGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-4550s21c1
Sequence:CCGGAGTAGTAAAGAGAACTTGGATCTCGAGATCCAAGTTCTCTTTACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-4787s21c1
Sequence:CCGGAGAGAAGATACTCGTATTAAGCTCGAGCTTAATACGAGTATCTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-4112s21c1
Sequence:CCGGCCCATCCTGATTATTCACCTTCTCGAGAAGGTGAATAATCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-3711s21c1
Sequence:CCGGCCCAGGATTGTGACGACAGTACTCGAGTACTGTCGTCACAATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032582.3-4147s21c1
Sequence:CCGGTGTAAATGGTCGGTGGATAAACTCGAGTTTATCCACCGACCATTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks