EMAIL THIS PAGE TO A FRIEND

USP32P2

ubiquitin specific peptidase 32 pseudogene 2

Synonyms: TL132
Species: Human USP32P2(220594)
Gene ID:
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0220594M3 Monoclonal Anti-LOC220594 antibody produced in mouse clone 3A2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145809 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145809 Rosetta Predictions human pricing
NR_003554 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202893 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379514 predicted 784
2 SASI_Hs02_00379515 predicted 2888
3 SASI_Hs02_00379516 predicted 869
4 SASI_Hs02_00379517 predicted 767
5 SASI_Hs02_00379518 predicted 367
6 SASI_Hs02_00379519 predicted 260
7 SASI_Hs02_00379520 predicted 753
8 SASI_Hs02_00379521 predicted 293
9 SASI_Hs02_00379522 predicted 365
10 SASI_Hs02_00379523 predicted 580
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145809
USP32P2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 32 pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145809.1-3344s1c1
Sequence:CCGGCCCAGACATTAGGAGTTCATACTCGAGTATGAACTCCTAATGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145809.1-1274s1c1
Sequence:CCGGCACTGCTTTAGCAACAAAGAACTCGAGTTCTTTGTTGCTAAAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145809.1-1988s1c1
Sequence:CCGGCCAAAGAGAAGACACTCATATCTCGAGATATGAGTGTCTTCTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145809.1-1318s1c1
Sequence:CCGGCCTTCCTGATTATTCACCTTACTCGAGTAAGGTGAATAATCAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145809.1-2205s1c1
Sequence:CCGGGCACAATTTCTGCCAAAGATTCTCGAGAATCTTTGGCAGAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145809
USP32P2 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 32 pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145809.1-3344s1c1
Sequence:CCGGCCCAGACATTAGGAGTTCATACTCGAGTATGAACTCCTAATGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145809.1-1274s1c1
Sequence:CCGGCACTGCTTTAGCAACAAAGAACTCGAGTTCTTTGTTGCTAAAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145809.1-1988s1c1
Sequence:CCGGCCAAAGAGAAGACACTCATATCTCGAGATATGAGTGTCTTCTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145809.1-1318s1c1
Sequence:CCGGCCTTCCTGATTATTCACCTTACTCGAGTAAGGTGAATAATCAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145809.1-2205s1c1
Sequence:CCGGGCACAATTTCTGCCAAAGATTCTCGAGAATCTTTGGCAGAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145809
USP32P2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 32 pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145809.1-3344s1c1
Sequence:CCGGCCCAGACATTAGGAGTTCATACTCGAGTATGAACTCCTAATGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145809.1-1274s1c1
Sequence:CCGGCACTGCTTTAGCAACAAAGAACTCGAGTTCTTTGTTGCTAAAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145809.1-1988s1c1
Sequence:CCGGCCAAAGAGAAGACACTCATATCTCGAGATATGAGTGTCTTCTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145809.1-1318s1c1
Sequence:CCGGCCTTCCTGATTATTCACCTTACTCGAGTAAGGTGAATAATCAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145809.1-2205s1c1
Sequence:CCGGGCACAATTTCTGCCAAAGATTCTCGAGAATCTTTGGCAGAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks