EMAIL THIS PAGE TO A FRIEND

USP33

ubiquitin specific peptidase 33

Synonyms: VDU1
UniProtKB ID: Q8TEY7, Q8TEY6, Q96AV6, Q9H9F0, Q9UPQ5
Gene ID:
Human(23032) Summary: This gene encodes a deubiquinating enzyme important in a variety of processes, including Slit-dependent cell migration and beta-2 adrenergic receptor signaling. The protein is negatively regulated through ubiquitination by von Hippel-Lindau tumor protein (VHL). Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Mouse(170822) ubiquitin specific peptidase 33
Rat(310960) ubiquitin specific peptidase 33
Zebrafish(406508) ubiquitin specific peptidase 33
Horse(100053171) ubiquitin specific peptidase 33
domestic cat(101088679) ubiquitin specific peptidase 33
dog(479984) ubiquitin specific peptidase 33
chicken(424553) ubiquitin specific peptidase 33
cow(531706) ubiquitin specific peptidase 33
sheep(101122479) ubiquitin specific peptidase 33
domestic guinea pig(100714166) ubiquitin specific peptidase 33
naked mole-rat(101704161) ubiquitin specific peptidase 33
188 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133247 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133247 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133247 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015017 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085371 MISSION® esiRNA esiRNA human USP33 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015017 Rosetta Predictions human pricing
NM_201624 Rosetta Predictions human pricing
NM_201626 Rosetta Predictions human pricing
XM_001068666 Rosetta Predictions rat pricing
XM_001080019 Rosetta Predictions rat pricing
NM_001076676 Rosetta Predictions mouse pricing
NM_133247 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180288 predicted 1611
2 SASI_Hs01_00180289 predicted 1759
3 SASI_Hs01_00180290 predicted 1537
4 SASI_Hs01_00180291 predicted 671
5 SASI_Hs02_00346799 predicted 664
6 SASI_Hs01_00180292 predicted 1635
7 SASI_Hs01_00180294 predicted 1162
8 SASI_Hs01_00180296 predicted 1669
9 SASI_Hs02_00346800 predicted 1742
10 SASI_Hs02_00346801 predicted 680
11 SASI_Hs01_00180287 predicted 737
12 SASI_Hs01_00180293 predicted 640
13 SASI_Hs01_00180295 predicted 2305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015788 predicted 1429
2 SASI_Hs01_00015789 predicted 1573
3 SASI_Hs01_00015790 predicted 1359
4 SASI_Hs01_00015791 predicted 490
5 SASI_Hs02_00373129 predicted 488
6 SASI_Hs01_00015792 predicted 1458
7 SASI_Hs01_00015794 predicted 984
8 SASI_Hs01_00015796 predicted 1492
9 SASI_Hs02_00373130 predicted 1564
10 SASI_Hs02_00373131 predicted 499
11 SASI_Hs01_00015787 predicted 562
12 SASI_Hs01_00015793 predicted 463
13 SASI_Hs01_00015795 predicted 2120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142382 predicted 1613
2 SASI_Hs01_00142383 predicted 1757
3 SASI_Hs01_00142384 predicted 1533
4 SASI_Hs01_00142385 predicted 675
5 SASI_Hs02_00373132 predicted 662
6 SASI_Hs01_00142386 predicted 1637
7 SASI_Hs01_00142388 predicted 1157
8 SASI_Hs01_00142390 predicted 1667
9 SASI_Hs02_00373133 predicted 1742
10 SASI_Hs02_00373134 predicted 680
11 SASI_Hs01_00142381 predicted 739
12 SASI_Hs01_00142387 predicted 641
13 SASI_Hs01_00142389 predicted 2276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325379 predicted 2977
2 SASI_Rn02_00325380 predicted 2866
3 SASI_Rn02_00325381 predicted 3092
4 SASI_Rn02_00325382 predicted 2926
5 SASI_Rn02_00325383 predicted 2879
6 SASI_Rn02_00325384 predicted 3299
7 SASI_Rn02_00325385 predicted 3008
8 SASI_Rn02_00325386 predicted 3162
9 SASI_Rn02_00325387 predicted 3271
10 SASI_Rn02_00325388 predicted 2909
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366258 predicted 2033
2 SASI_Rn02_00366259 predicted 2862
3 SASI_Rn02_00366260 predicted 317
4 SASI_Rn02_00366261 predicted 2321
5 SASI_Rn02_00366262 predicted 1310
6 SASI_Rn02_00366263 predicted 2699
7 SASI_Rn02_00366264 predicted 362
8 SASI_Rn02_00366265 predicted 2922
9 SASI_Rn02_00366266 predicted 1983
10 SASI_Rn02_00366267 predicted 2356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292319 predicted 2085
2 SASI_Mm02_00292320 predicted 2963
3 SASI_Mm02_00292321 predicted 2026
4 SASI_Mm02_00292322 predicted 677
5 SASI_Mm02_00292323 predicted 436
6 SASI_Mm02_00292324 predicted 1419
7 SASI_Mm02_00292325 predicted 442
8 SASI_Mm02_00292326 predicted 2042
9 SASI_Mm02_00292327 predicted 563
10 SASI_Mm02_00292328 predicted 2402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133247 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115966 predicted 2112
2 SASI_Mm01_00115967 predicted 3004
3 SASI_Mm01_00115968 predicted 2057
4 SASI_Mm01_00115970 predicted 682
5 SASI_Mm01_00115973 predicted 446
6 SASI_Mm02_00338500 predicted 1428
7 SASI_Mm02_00338501 predicted 453
8 SASI_Mm02_00338502 predicted 2073
9 SASI_Mm01_00115974 predicted 568
10 SASI_Mm02_00338503 predicted 2440
11 SASI_Mm01_00115965 predicted 2378
12 SASI_Mm01_00115969 predicted 605
13 SASI_Mm01_00115971 predicted 1758
14 SASI_Mm01_00115972 predicted 1556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133247
VALIDATED
USP33 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 33
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133247.1-2429s1c1
Sequence:CCGGGCGAGTTATATTGAAGACTTACTCGAGTAAGTCTTCAATATAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133247.1-497s1c1
Sequence:CCGGCCTCCTTCATTACCTCATGTACTCGAGTACATGAGGTAATGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133247.1-902s1c1
Sequence:CCGGCGAGGTTATTCTCAGCAGGATCTCGAGATCCTGCTGAGAATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133247.1-2369s1c1
Sequence:CCGGCCTGGCCCTATTTCAAATAATCTCGAGATTATTTGAAATAGGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133247.1-432s1c1
Sequence:CCGGCCACTCTTCGAGTATGGTGTTCTCGAGAACACCATACTCGAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133247.2-1585s21c1
Sequence:CCGGACGTGCGATAGGGTGTCTATACTCGAGTATAGACACCCTATCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133247.2-242s21c1
Sequence:CCGGTGGATTCAGTTGGTGAAATAACTCGAGTTATTTCACCAACTGAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133247.2-3066s21c1
Sequence:CCGGGGCATTATGGAAGGGTATATTCTCGAGAATATACCCTTCCATAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133247.2-2377s21c1
Sequence:CCGGCCTGGCCCTATTTCAAATAATCTCGAGATTATTTGAAATAGGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133247.2-1529s21c1
Sequence:CCGGGAAGTGTCATCTCCGACATATCTCGAGATATGTCGGAGATGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133247
VALIDATED
USP33 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 33
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133247.1-2429s1c1
Sequence:CCGGGCGAGTTATATTGAAGACTTACTCGAGTAAGTCTTCAATATAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133247.1-497s1c1
Sequence:CCGGCCTCCTTCATTACCTCATGTACTCGAGTACATGAGGTAATGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133247.1-902s1c1
Sequence:CCGGCGAGGTTATTCTCAGCAGGATCTCGAGATCCTGCTGAGAATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133247.1-2369s1c1
Sequence:CCGGCCTGGCCCTATTTCAAATAATCTCGAGATTATTTGAAATAGGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133247.1-432s1c1
Sequence:CCGGCCACTCTTCGAGTATGGTGTTCTCGAGAACACCATACTCGAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133247.2-1585s21c1
Sequence:CCGGACGTGCGATAGGGTGTCTATACTCGAGTATAGACACCCTATCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133247.2-242s21c1
Sequence:CCGGTGGATTCAGTTGGTGAAATAACTCGAGTTATTTCACCAACTGAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133247.2-3066s21c1
Sequence:CCGGGGCATTATGGAAGGGTATATTCTCGAGAATATACCCTTCCATAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133247.2-2377s21c1
Sequence:CCGGCCTGGCCCTATTTCAAATAATCTCGAGATTATTTGAAATAGGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133247.2-1529s21c1
Sequence:CCGGGAAGTGTCATCTCCGACATATCTCGAGATATGTCGGAGATGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133247
VALIDATED
USP33 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 33
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133247.1-2429s1c1
Sequence:CCGGGCGAGTTATATTGAAGACTTACTCGAGTAAGTCTTCAATATAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133247.1-497s1c1
Sequence:CCGGCCTCCTTCATTACCTCATGTACTCGAGTACATGAGGTAATGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133247.1-902s1c1
Sequence:CCGGCGAGGTTATTCTCAGCAGGATCTCGAGATCCTGCTGAGAATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133247.1-2369s1c1
Sequence:CCGGCCTGGCCCTATTTCAAATAATCTCGAGATTATTTGAAATAGGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133247.1-432s1c1
Sequence:CCGGCCACTCTTCGAGTATGGTGTTCTCGAGAACACCATACTCGAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133247.2-1585s21c1
Sequence:CCGGACGTGCGATAGGGTGTCTATACTCGAGTATAGACACCCTATCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133247.2-242s21c1
Sequence:CCGGTGGATTCAGTTGGTGAAATAACTCGAGTTATTTCACCAACTGAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133247.2-3066s21c1
Sequence:CCGGGGCATTATGGAAGGGTATATTCTCGAGAATATACCCTTCCATAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133247.2-2377s21c1
Sequence:CCGGCCTGGCCCTATTTCAAATAATCTCGAGATTATTTGAAATAGGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133247.2-1529s21c1
Sequence:CCGGGAAGTGTCATCTCCGACATATCTCGAGATATGTCGGAGATGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015017
VALIDATED
USP33 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 33
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-3895s1c1
Sequence:CCGGGTGGAATTTGTCAGCAGATATCTCGAGATATCTGCTGACAAATTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-2923s1c1
Sequence:CCGGCCTCCGGTTGTTCATGTTGATCTCGAGATCAACATGAACAACCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-673s1c1
Sequence:CCGGCTGGATATAGAAGCGGATGAACTCGAGTTCATCCGCTTCTATATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-2526s1c1
Sequence:CCGGGCCTCAGAACATTTGGGATAACTCGAGTTATCCCAAATGTTCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-1142s1c1
Sequence:CCGGGCAACAGTGATAGAGCAGAAACTCGAGTTTCTGCTCTATCACTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015017.3-4074s21c1
Sequence:CCGGGTGGAATTTGTCAGCAGATATCTCGAGATATCTGCTGACAAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015017.3-3102s21c1
Sequence:CCGGCCTCCGGTTGTTCATGTTGATCTCGAGATCAACATGAACAACCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015017.3-1321s21c1
Sequence:CCGGGCAACAGTGATAGAGCAGAAACTCGAGTTTCTGCTCTATCACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015017.3-852s21c1
Sequence:CCGGCTGGATATAGAAGCGGATGAACTCGAGTTCATCCGCTTCTATATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015017
VALIDATED
USP33 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 33
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-3895s1c1
Sequence:CCGGGTGGAATTTGTCAGCAGATATCTCGAGATATCTGCTGACAAATTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-2923s1c1
Sequence:CCGGCCTCCGGTTGTTCATGTTGATCTCGAGATCAACATGAACAACCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-673s1c1
Sequence:CCGGCTGGATATAGAAGCGGATGAACTCGAGTTCATCCGCTTCTATATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-2526s1c1
Sequence:CCGGGCCTCAGAACATTTGGGATAACTCGAGTTATCCCAAATGTTCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-1142s1c1
Sequence:CCGGGCAACAGTGATAGAGCAGAAACTCGAGTTTCTGCTCTATCACTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015017.3-4074s21c1
Sequence:CCGGGTGGAATTTGTCAGCAGATATCTCGAGATATCTGCTGACAAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015017.3-3102s21c1
Sequence:CCGGCCTCCGGTTGTTCATGTTGATCTCGAGATCAACATGAACAACCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015017.3-1321s21c1
Sequence:CCGGGCAACAGTGATAGAGCAGAAACTCGAGTTTCTGCTCTATCACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015017.3-852s21c1
Sequence:CCGGCTGGATATAGAAGCGGATGAACTCGAGTTCATCCGCTTCTATATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015017
VALIDATED
USP33 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 33
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-3895s1c1
Sequence:CCGGGTGGAATTTGTCAGCAGATATCTCGAGATATCTGCTGACAAATTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-2923s1c1
Sequence:CCGGCCTCCGGTTGTTCATGTTGATCTCGAGATCAACATGAACAACCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-673s1c1
Sequence:CCGGCTGGATATAGAAGCGGATGAACTCGAGTTCATCCGCTTCTATATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-2526s1c1
Sequence:CCGGGCCTCAGAACATTTGGGATAACTCGAGTTATCCCAAATGTTCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015017.x-1142s1c1
Sequence:CCGGGCAACAGTGATAGAGCAGAAACTCGAGTTTCTGCTCTATCACTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015017.3-4074s21c1
Sequence:CCGGGTGGAATTTGTCAGCAGATATCTCGAGATATCTGCTGACAAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015017.3-3102s21c1
Sequence:CCGGCCTCCGGTTGTTCATGTTGATCTCGAGATCAACATGAACAACCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015017.3-1321s21c1
Sequence:CCGGGCAACAGTGATAGAGCAGAAACTCGAGTTTCTGCTCTATCACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015017.3-852s21c1
Sequence:CCGGCTGGATATAGAAGCGGATGAACTCGAGTTCATCCGCTTCTATATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks