EMAIL THIS PAGE TO A FRIEND

USP34

ubiquitin specific peptidase 34

Gene ID:
Mouse(17847) ubiquitin specific peptidase 34
Rat(360990) ubiquitin specific peptidase 34
Domestic Rabbit(100354261) ubiquitin specific peptidase 34
domestic guinea pig(100732825) ubiquitin specific peptidase 34
cow(534067) ubiquitin specific peptidase 34
sheep(101120484) ubiquitin specific peptidase 34
Zebrafish(562779) ubiquitin specific peptidase 34
chicken(421193) ubiquitin specific peptidase 34
dog(474608) ubiquitin specific peptidase 34
Horse(100064939) ubiquitin specific peptidase 34
domestic cat(101084277) ubiquitin specific peptidase 34
131 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_483996 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_483996 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_483996 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014709 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014709 Rosetta Predictions human pricing
XM_341264 Rosetta Predictions rat pricing
XR_005456 Rosetta Predictions rat pricing
XR_009611 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089169 predicted 1783
2 SASI_Hs02_00346129 predicted 3721
3 SASI_Hs01_00089170 predicted 5398
4 SASI_Hs01_00089171 predicted 9013
5 SASI_Hs01_00089173 predicted 6763
6 SASI_Hs01_00089175 predicted 4993
7 SASI_Hs02_00346130 predicted 4923
8 SASI_Hs02_00346131 predicted 9038
9 SASI_Hs01_00089177 predicted 3633
10 SASI_Hs01_00089178 predicted 5086
11 SASI_Hs01_00089172 predicted 6181
12 SASI_Hs01_00089174 predicted 3239
13 SASI_Hs01_00089176 predicted 2800
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341264 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00183153 predicted 3994
2 SASI_Rn01_00183154 predicted 1508
3 SASI_Rn01_00183155 predicted 4674
4 SASI_Rn01_00183156 predicted 5193
5 SASI_Rn01_00183157 predicted 203
6 SASI_Rn01_00183158 predicted 905
7 SASI_Rn01_00183159 predicted 1656
8 SASI_Rn01_00183160 predicted 3867
9 SASI_Rn01_00183161 predicted 3145
10 SASI_Rn01_00183162 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005456 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00409337 predicted 1214
2 SASI_Rn02_00409338 predicted 5357
3 SASI_Rn02_00409339 predicted 11118
4 SASI_Rn02_00409340 predicted 5482
5 SASI_Rn02_00409341 predicted 2838
6 SASI_Rn02_00409342 predicted 3479
7 SASI_Rn02_00409343 predicted 7000
8 SASI_Rn02_00409344 predicted 9204
9 SASI_Rn02_00409345 predicted 1330
10 SASI_Rn02_00409346 predicted 9342
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009611 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420295 predicted 1211
2 SASI_Rn02_00420296 predicted 5357
3 SASI_Rn02_00420297 predicted 11105
4 SASI_Rn02_00420298 predicted 5479
5 SASI_Rn02_00420299 predicted 2833
6 SASI_Rn02_00420300 predicted 3466
7 SASI_Rn02_00420301 predicted 6996
8 SASI_Rn02_00420302 predicted 9197
9 SASI_Rn02_00420303 predicted 1324
10 SASI_Rn02_00420304 predicted 9337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_483996
USP34 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 34
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-2567s21c1
Sequence:CCGGAGATTGAGGGCACCGGTATTACTCGAGTAATACCGGTGCCCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-964s21c1
Sequence:GTACCGGATGGATGAGCAGCTTATTAATCTCGAGATTAATAAGCTGCTCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-71s21c1
Sequence:CCGGGACAGAGTGCGGCTCGTAATACTCGAGTATTACGAGCCGCACTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-552s21c1
Sequence:CCGGGAAGCACTGTAGTCGATATATCTCGAGATATATCGACTACAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-1657s21c1
Sequence:CCGGCAAGATGATGATGCAATTAATCTCGAGATTAATTGCATCATCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_483996
USP34 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 34
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-2567s21c1
Sequence:CCGGAGATTGAGGGCACCGGTATTACTCGAGTAATACCGGTGCCCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-964s21c1
Sequence:GTACCGGATGGATGAGCAGCTTATTAATCTCGAGATTAATAAGCTGCTCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-71s21c1
Sequence:CCGGGACAGAGTGCGGCTCGTAATACTCGAGTATTACGAGCCGCACTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-552s21c1
Sequence:CCGGGAAGCACTGTAGTCGATATATCTCGAGATATATCGACTACAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-1657s21c1
Sequence:CCGGCAAGATGATGATGCAATTAATCTCGAGATTAATTGCATCATCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_483996
USP34 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 34
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-2567s21c1
Sequence:CCGGAGATTGAGGGCACCGGTATTACTCGAGTAATACCGGTGCCCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-964s21c1
Sequence:GTACCGGATGGATGAGCAGCTTATTAATCTCGAGATTAATAAGCTGCTCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-71s21c1
Sequence:CCGGGACAGAGTGCGGCTCGTAATACTCGAGTATTACGAGCCGCACTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-552s21c1
Sequence:CCGGGAAGCACTGTAGTCGATATATCTCGAGATATATCGACTACAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_483996.3-1657s21c1
Sequence:CCGGCAAGATGATGATGCAATTAATCTCGAGATTAATTGCATCATCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014709
VALIDATED
USP34 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 34
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014709.3-740s21c1
Sequence:CCGGCTTATAGCACATGCGTTTATTCTCGAGAATAAACGCATGTGCTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014709.3-11140s21c1
Sequence:CCGGGCTGTGGCCTGGCAGTATATACTCGAGTATATACTGCCAGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_014709.3-1137s21c1
Sequence:GTACCGGACAATGTGGTGGAGCATATATCTCGAGATATATGCTCCACCACATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014709.3-1228s21c1
Sequence:CCGGGCGACTGAGTACTCAACATATCTCGAGATATGTTGAGTACTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014709.3-561s21c1
Sequence:CCGGACCCTACTATTGAGGATATATCTCGAGATATATCCTCAATAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014709.2-7984s1c1
Sequence:CCGGCCAGAGAATATCCGCCTTATTCTCGAGAATAAGGCGGATATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014709.2-412s1c1
Sequence:CCGGGCTCGTAACATGGCTGACTTACTCGAGTAAGTCAGCCATGTTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014709.2-1390s1c1
Sequence:CCGGGCAGATATTGAAGCCCTCAAACTCGAGTTTGAGGGCTTCAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014709.2-8625s1c1
Sequence:CCGGGCGAATTGAATTTGCCCATAACTCGAGTTATGGGCAAATTCAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014709
VALIDATED
USP34 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 34
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014709.3-740s21c1
Sequence:CCGGCTTATAGCACATGCGTTTATTCTCGAGAATAAACGCATGTGCTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014709.3-11140s21c1
Sequence:CCGGGCTGTGGCCTGGCAGTATATACTCGAGTATATACTGCCAGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_014709.3-1137s21c1
Sequence:GTACCGGACAATGTGGTGGAGCATATATCTCGAGATATATGCTCCACCACATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014709.3-1228s21c1
Sequence:CCGGGCGACTGAGTACTCAACATATCTCGAGATATGTTGAGTACTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014709.3-561s21c1
Sequence:CCGGACCCTACTATTGAGGATATATCTCGAGATATATCCTCAATAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014709.2-7984s1c1
Sequence:CCGGCCAGAGAATATCCGCCTTATTCTCGAGAATAAGGCGGATATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014709.2-412s1c1
Sequence:CCGGGCTCGTAACATGGCTGACTTACTCGAGTAAGTCAGCCATGTTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014709.2-1390s1c1
Sequence:CCGGGCAGATATTGAAGCCCTCAAACTCGAGTTTGAGGGCTTCAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014709.2-8625s1c1
Sequence:CCGGGCGAATTGAATTTGCCCATAACTCGAGTTATGGGCAAATTCAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014709
VALIDATED
USP34 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 34
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014709.3-740s21c1
Sequence:CCGGCTTATAGCACATGCGTTTATTCTCGAGAATAAACGCATGTGCTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014709.3-11140s21c1
Sequence:CCGGGCTGTGGCCTGGCAGTATATACTCGAGTATATACTGCCAGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_014709.3-1137s21c1
Sequence:GTACCGGACAATGTGGTGGAGCATATATCTCGAGATATATGCTCCACCACATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014709.3-1228s21c1
Sequence:CCGGGCGACTGAGTACTCAACATATCTCGAGATATGTTGAGTACTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014709.3-561s21c1
Sequence:CCGGACCCTACTATTGAGGATATATCTCGAGATATATCCTCAATAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014709.2-7984s1c1
Sequence:CCGGCCAGAGAATATCCGCCTTATTCTCGAGAATAAGGCGGATATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014709.2-412s1c1
Sequence:CCGGGCTCGTAACATGGCTGACTTACTCGAGTAAGTCAGCCATGTTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014709.2-1390s1c1
Sequence:CCGGGCAGATATTGAAGCCCTCAAACTCGAGTTTGAGGGCTTCAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014709.2-8625s1c1
Sequence:CCGGGCGAATTGAATTTGCCCATAACTCGAGTTATGGGCAAATTCAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks