EMAIL THIS PAGE TO A FRIEND

USP35

ubiquitin specific peptidase 35

UniProtKB ID: Q9P2H5
Gene ID:
Mouse(244144) ubiquitin specific peptidase 35
Rat(308834) ubiquitin specific peptidase 35
chicken(419030) ubiquitin specific peptidase 35
domestic cat(101086000) ubiquitin specific peptidase 35
dog(485168) ubiquitin specific peptidase 35
cow(525702) ubiquitin specific peptidase 35
sheep(101109133) ubiquitin specific peptidase 35
domestic guinea pig(100735366) ubiquitin specific peptidase 35
naked mole-rat(101719599) ubiquitin specific peptidase 35
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_145945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_145945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_145945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020798 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020798 Rosetta Predictions human pricing
XM_290527 Rosetta Predictions human pricing
XM_935134 Rosetta Predictions human pricing
XM_935137 Rosetta Predictions human pricing
XM_001064027 Rosetta Predictions rat pricing
XM_238899 Rosetta Predictions rat pricing
XM_886523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353962 predicted 1553
2 SASI_Hs02_00353963 predicted 1124
3 SASI_Hs02_00353964 predicted 1040
4 SASI_Hs02_00353965 predicted 1960
5 SASI_Hs02_00353966 predicted 1639
6 SASI_Hs02_00353967 predicted 3384
7 SASI_Hs02_00353968 predicted 1420
8 SASI_Hs02_00353969 predicted 3269
9 SASI_Hs02_00353970 predicted 2776
10 SASI_Hs02_00353971 predicted 1921
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255571 predicted 1565
2 SASI_Hs01_00255572 predicted 1140
3 SASI_Hs01_00255573 predicted 1050
4 SASI_Hs01_00255574 predicted 1965
5 SASI_Hs01_00255575 predicted 1652
6 SASI_Hs01_00255576 predicted 3395
7 SASI_Hs01_00255577 predicted 1428
8 SASI_Hs01_00255578 predicted 3282
9 SASI_Hs01_00255579 predicted 2779
10 SASI_Hs01_00255580 predicted 1932
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288623 predicted 1516
2 SASI_Hs01_00288624 predicted 1552
3 SASI_Hs01_00288625 predicted 1085
4 SASI_Hs01_00288626 predicted 1924
5 SASI_Hs01_00288627 predicted 1598
6 SASI_Hs01_00288628 predicted 3354
7 SASI_Hs01_00288629 predicted 1380
8 SASI_Hs01_00288630 predicted 3237
9 SASI_Hs01_00288631 predicted 2732
10 SASI_Hs01_00288632 predicted 1885
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291572 predicted 2187
2 SASI_Hs01_00291573 predicted 2288
3 SASI_Hs01_00291574 predicted 757
4 SASI_Hs01_00291575 predicted 2325
5 SASI_Hs01_00291576 predicted 2185
6 SASI_Hs01_00291577 predicted 1798
7 SASI_Hs01_00291578 predicted 859
8 SASI_Hs01_00291579 predicted 700
9 SASI_Hs01_00291580 predicted 1560
10 SASI_Hs01_00291581 predicted 1939
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309088 predicted 2930
2 SASI_Rn02_00309089 predicted 876
3 SASI_Rn02_00309090 predicted 1551
4 SASI_Rn02_00309091 predicted 2499
5 SASI_Rn02_00309092 predicted 1719
6 SASI_Rn02_00309093 predicted 1166
7 SASI_Rn02_00309094 predicted 1696
8 SASI_Rn02_00309095 predicted 852
9 SASI_Rn02_00309096 predicted 1366
10 SASI_Rn02_00309097 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391466 predicted 1709
2 SASI_Rn02_00391467 predicted 878
3 SASI_Rn02_00391468 predicted 1550
4 SASI_Rn02_00391469 predicted 2499
5 SASI_Rn02_00391470 predicted 1725
6 SASI_Rn02_00391471 predicted 1162
7 SASI_Rn02_00391472 predicted 1308
8 SASI_Rn02_00391473 predicted 2400
9 SASI_Rn02_00391474 predicted 796
10 SASI_Rn02_00391475 predicted 2379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00428349 predicted 1576
2 SASI_Mm02_00428350 predicted 2426
3 SASI_Mm01_00266624 predicted 1560
4 SASI_Mm02_00428351 predicted 2638
5 SASI_Mm02_00428352 predicted 1548
6 SASI_Mm02_00428353 predicted 1331
7 SASI_Mm02_00428354 predicted 2631
8 SASI_Mm01_00266630 predicted 2407
9 SASI_Mm01_00266632 predicted 2502
10 SASI_Mm02_00428355 predicted 2379
11 SASI_Mm01_00266625 predicted 1734
12 SASI_Mm01_00266626 predicted 886
13 SASI_Mm01_00266627 predicted 859
14 SASI_Mm01_00266628 predicted 761
15 SASI_Mm01_00266629 predicted 2436
16 SASI_Mm01_00266631 predicted 1013
17 SASI_Mm01_00266633 predicted 2570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_145945
USP35 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 35
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-803s1c1
Sequence:CCGGGCAAGATTGTGACCCGGATATCTCGAGATATCCGGGTCACAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-639s1c1
Sequence:CCGGCCAGCAAGACTGTTCAGAGTACTCGAGTACTCTGAACAGTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-495s1c1
Sequence:CCGGGCTCCGCTTGACTGAGAACAACTCGAGTTGTTCTCAGTCAAGCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-1468s1c1
Sequence:CCGGCGCTACCTCATCCTCACACTACTCGAGTAGTGTGAGGATGAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-1522s1c1
Sequence:CCGGCGGCGTAAGATCCTGGACGATCTCGAGATCGTCCAGGATCTTACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_145945
USP35 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 35
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-803s1c1
Sequence:CCGGGCAAGATTGTGACCCGGATATCTCGAGATATCCGGGTCACAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-639s1c1
Sequence:CCGGCCAGCAAGACTGTTCAGAGTACTCGAGTACTCTGAACAGTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-495s1c1
Sequence:CCGGGCTCCGCTTGACTGAGAACAACTCGAGTTGTTCTCAGTCAAGCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-1468s1c1
Sequence:CCGGCGCTACCTCATCCTCACACTACTCGAGTAGTGTGAGGATGAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-1522s1c1
Sequence:CCGGCGGCGTAAGATCCTGGACGATCTCGAGATCGTCCAGGATCTTACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_145945
USP35 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 35
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-803s1c1
Sequence:CCGGGCAAGATTGTGACCCGGATATCTCGAGATATCCGGGTCACAATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-639s1c1
Sequence:CCGGCCAGCAAGACTGTTCAGAGTACTCGAGTACTCTGAACAGTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-495s1c1
Sequence:CCGGGCTCCGCTTGACTGAGAACAACTCGAGTTGTTCTCAGTCAAGCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-1468s1c1
Sequence:CCGGCGCTACCTCATCCTCACACTACTCGAGTAGTGTGAGGATGAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145945.3-1522s1c1
Sequence:CCGGCGGCGTAAGATCCTGGACGATCTCGAGATCGTCCAGGATCTTACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020798
USP35 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 35
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020798.1-1606s21c1
Sequence:CCGGAGCATCCTTCAGGCCTTATTCCTCGAGGAATAAGGCCTGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020798.1-3676s21c1
Sequence:CCGGCCGACTGCTGTACGGTATAAACTCGAGTTTATACCGTACAGCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020798.1-1028s21c1
Sequence:CCGGCGCAGATGCTGACTGCCATTACTCGAGTAATGGCAGTCAGCATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020798.1-1550s21c1
Sequence:CCGGAGTCAGACACGGGCAAGATTGCTCGAGCAATCTTGCCCGTGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020798.1-1088s21c1
Sequence:CCGGATATTGACAAGTGGATCATTGCTCGAGCAATGATCCACTTGTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020798
USP35 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 35
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020798.1-1606s21c1
Sequence:CCGGAGCATCCTTCAGGCCTTATTCCTCGAGGAATAAGGCCTGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020798.1-3676s21c1
Sequence:CCGGCCGACTGCTGTACGGTATAAACTCGAGTTTATACCGTACAGCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020798.1-1028s21c1
Sequence:CCGGCGCAGATGCTGACTGCCATTACTCGAGTAATGGCAGTCAGCATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020798.1-1550s21c1
Sequence:CCGGAGTCAGACACGGGCAAGATTGCTCGAGCAATCTTGCCCGTGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020798.1-1088s21c1
Sequence:CCGGATATTGACAAGTGGATCATTGCTCGAGCAATGATCCACTTGTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020798
USP35 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 35
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020798.1-1606s21c1
Sequence:CCGGAGCATCCTTCAGGCCTTATTCCTCGAGGAATAAGGCCTGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020798.1-3676s21c1
Sequence:CCGGCCGACTGCTGTACGGTATAAACTCGAGTTTATACCGTACAGCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020798.1-1028s21c1
Sequence:CCGGCGCAGATGCTGACTGCCATTACTCGAGTAATGGCAGTCAGCATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020798.1-1550s21c1
Sequence:CCGGAGTCAGACACGGGCAAGATTGCTCGAGCAATCTTGCCCGTGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020798.1-1088s21c1
Sequence:CCGGATATTGACAAGTGGATCATTGCTCGAGCAATGATCCACTTGTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks