EMAIL THIS PAGE TO A FRIEND

USP36

ubiquitin specific peptidase 36

Synonyms: DUB1
UniProtKB ID: Q9P275, Q05C98, Q05DD0, Q6IQ38, Q8NDM8, Q9NVC8
Gene ID:
Human(57602) Summary: Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP36 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]
Mouse(72344) ubiquitin specific peptidase 36
Rat(303700) ubiquitin specific peptidase 36
naked mole-rat(101706807) ubiquitin specific peptidase 36
Domestic Rabbit(100345304) ubiquitin specific peptidase 36
domestic guinea pig(100731912) ubiquitin specific peptidase 36
cow(504581) ubiquitin specific peptidase 36
sheep(101112747) ubiquitin specific peptidase 36
Zebrafish(327239) ubiquitin specific peptidase 36
chicken(426457) ubiquitin specific peptidase 36
dog(483344) ubiquitin specific peptidase 36
domestic cat(101082865) ubiquitin specific peptidase 36
Horse(100057557) ubiquitin specific peptidase 36
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025090 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025090 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025090 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_126772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_126772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_126772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025090 Rosetta Predictions human pricing
NM_001107069 Rosetta Predictions rat pricing
XM_126772 Rosetta Predictions mouse pricing
XM_916680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357787 predicted 2296
2 SASI_Hs01_00194136 predicted 1380
3 SASI_Hs01_00194135 predicted 1288
4 SASI_Hs01_00194137 predicted 1463
5 SASI_Hs01_00194138 predicted 1267
6 SASI_Hs01_00194139 predicted 2288
7 SASI_Hs01_00194142 predicted 3411
8 SASI_Hs02_00357788 predicted 481
9 SASI_Hs02_00357789 predicted 1379
10 SASI_Hs02_00357790 predicted 322
11 SASI_Hs01_00194133 predicted 1480
12 SASI_Hs01_00194134 predicted 393
13 SASI_Hs01_00194140 predicted 1482
14 SASI_Hs01_00194141 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225186 predicted 1438
2 SASI_Rn02_00225187 predicted 3329
3 SASI_Rn02_00225188 predicted 2389
4 SASI_Rn02_00225189 predicted 2888
5 SASI_Rn02_00225190 predicted 856
6 SASI_Rn02_00225191 predicted 1089
7 SASI_Rn02_00225192 predicted 3277
8 SASI_Rn02_00225193 predicted 1621
9 SASI_Rn02_00225194 predicted 649
10 SASI_Rn02_00225195 predicted 2213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282053 predicted 1164
2 SASI_Mm01_00282054 predicted 1347
3 SASI_Mm01_00282055 predicted 759
4 SASI_Mm02_00424158 predicted 592
5 SASI_Mm01_00282056 predicted 995
6 SASI_Mm01_00282057 predicted 235
7 SASI_Mm01_00282058 predicted 1000
8 SASI_Mm01_00282059 predicted 1079
9 SASI_Mm01_00282060 predicted 367
10 SASI_Mm01_00282061 predicted 1225
11 SASI_Mm01_00282062 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440512 predicted 1166
2 SASI_Mm02_00440513 predicted 1349
3 SASI_Mm02_00440514 predicted 755
4 SASI_Mm02_00440515 predicted 590
5 SASI_Mm02_00440516 predicted 993
6 SASI_Mm02_00440517 predicted 232
7 SASI_Mm02_00440518 predicted 1000
8 SASI_Mm02_00440519 predicted 1080
9 SASI_Mm02_00440520 predicted 365
10 SASI_Mm02_00440521 predicted 1224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025090
VALIDATED
USP36 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 36
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025090.3-3797s21c1
Sequence:CCGGGGCGTGTGTGTATGATGTATGCTCGAGCATACATCATACACACACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1774s21c1
Sequence:CCGGAGAGATTGGTGTGCCCATATCCTCGAGGATATGGGCACACCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1009s21c1
Sequence:CCGGTGCCAAGTTGGATCGTCAAACCTCGAGGTTTGACGATCCAACTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-475s21c1
Sequence:CCGGCTACCAGCTGGAGGCCTTAAACTCGAGTTTAAGGCCTCCAGCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-3399s21c1
Sequence:CCGGTGGTCCAGGAACTGCTCAAATCTCGAGATTTGAGCAGTTCCTGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1987s21c1
Sequence:CCGGTGGGACCAGCAACTCGAATAGCTCGAGCTATTCGAGTTGCTGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1693s21c1
Sequence:CCGGCATCGGCAATGGGATTATTTCCTCGAGGAAATAATCCCATTGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1218s21c1
Sequence:CCGGATGCCTACATGTGTGCTAAATCTCGAGATTTAGCACACATGTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-1278s21c1
Sequence:GTACCGGACAGAACATCCAACGTCTTAACTCGAGTTAAGACGTTGGATGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-1038s21c1
Sequence:GTACCGGCTACCTTGGTCCATCAAATTTCTCGAGAAATTTGATGGACCAAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-4844s21c1
Sequence:CCGGCTGGAGAGCAGAGGCTATTTGCTCGAGCAAATAGCCTCTGCTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-1369s21c1
Sequence:CCGGCCTCAACATACGTCCGTATATCTCGAGATATACGGACGTATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-1148s21c1
Sequence:CCGGATCCGGCAAGCTGCGAATATTCTCGAGAATATTCGCAGCTTGCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025090.2-1575s1c1
Sequence:CCGGTCCAAGAAGAACATCGGCAATCTCGAGATTGCCGATGTTCTTCTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_025090.2-3363s1c1
Sequence:CCGGGCGGTCAGTCAGGATGCTATTCTCGAGAATAGCATCCTGACTGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025090.2-1888s1c1
Sequence:CCGGGCAACTCGAATAGCAGCAGATCTCGAGATCTGCTGCTATTCGAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025090.2-1272s1c1
Sequence:CCGGCGTCCGTATATGTCCCAGAATCTCGAGATTCTGGGACATATACGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022444    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_025090.2-5809s1c1
Sequence:CCGGGCGACTGAATATACACCTGTACTCGAGTACAGGTGTATATTCAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025090
VALIDATED
USP36 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 36
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025090.3-3797s21c1
Sequence:CCGGGGCGTGTGTGTATGATGTATGCTCGAGCATACATCATACACACACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1774s21c1
Sequence:CCGGAGAGATTGGTGTGCCCATATCCTCGAGGATATGGGCACACCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1009s21c1
Sequence:CCGGTGCCAAGTTGGATCGTCAAACCTCGAGGTTTGACGATCCAACTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-475s21c1
Sequence:CCGGCTACCAGCTGGAGGCCTTAAACTCGAGTTTAAGGCCTCCAGCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-3399s21c1
Sequence:CCGGTGGTCCAGGAACTGCTCAAATCTCGAGATTTGAGCAGTTCCTGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1987s21c1
Sequence:CCGGTGGGACCAGCAACTCGAATAGCTCGAGCTATTCGAGTTGCTGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1693s21c1
Sequence:CCGGCATCGGCAATGGGATTATTTCCTCGAGGAAATAATCCCATTGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1218s21c1
Sequence:CCGGATGCCTACATGTGTGCTAAATCTCGAGATTTAGCACACATGTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-1278s21c1
Sequence:GTACCGGACAGAACATCCAACGTCTTAACTCGAGTTAAGACGTTGGATGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-1038s21c1
Sequence:GTACCGGCTACCTTGGTCCATCAAATTTCTCGAGAAATTTGATGGACCAAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-4844s21c1
Sequence:CCGGCTGGAGAGCAGAGGCTATTTGCTCGAGCAAATAGCCTCTGCTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-1369s21c1
Sequence:CCGGCCTCAACATACGTCCGTATATCTCGAGATATACGGACGTATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-1148s21c1
Sequence:CCGGATCCGGCAAGCTGCGAATATTCTCGAGAATATTCGCAGCTTGCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025090.2-1575s1c1
Sequence:CCGGTCCAAGAAGAACATCGGCAATCTCGAGATTGCCGATGTTCTTCTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_025090.2-3363s1c1
Sequence:CCGGGCGGTCAGTCAGGATGCTATTCTCGAGAATAGCATCCTGACTGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025090.2-1888s1c1
Sequence:CCGGGCAACTCGAATAGCAGCAGATCTCGAGATCTGCTGCTATTCGAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025090.2-1272s1c1
Sequence:CCGGCGTCCGTATATGTCCCAGAATCTCGAGATTCTGGGACATATACGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022444    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_025090.2-5809s1c1
Sequence:CCGGGCGACTGAATATACACCTGTACTCGAGTACAGGTGTATATTCAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025090
VALIDATED
USP36 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 36
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025090.3-3797s21c1
Sequence:CCGGGGCGTGTGTGTATGATGTATGCTCGAGCATACATCATACACACACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1774s21c1
Sequence:CCGGAGAGATTGGTGTGCCCATATCCTCGAGGATATGGGCACACCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1009s21c1
Sequence:CCGGTGCCAAGTTGGATCGTCAAACCTCGAGGTTTGACGATCCAACTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-475s21c1
Sequence:CCGGCTACCAGCTGGAGGCCTTAAACTCGAGTTTAAGGCCTCCAGCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-3399s21c1
Sequence:CCGGTGGTCCAGGAACTGCTCAAATCTCGAGATTTGAGCAGTTCCTGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1987s21c1
Sequence:CCGGTGGGACCAGCAACTCGAATAGCTCGAGCTATTCGAGTTGCTGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1693s21c1
Sequence:CCGGCATCGGCAATGGGATTATTTCCTCGAGGAAATAATCCCATTGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025090.3-1218s21c1
Sequence:CCGGATGCCTACATGTGTGCTAAATCTCGAGATTTAGCACACATGTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-1278s21c1
Sequence:GTACCGGACAGAACATCCAACGTCTTAACTCGAGTTAAGACGTTGGATGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-1038s21c1
Sequence:GTACCGGCTACCTTGGTCCATCAAATTTCTCGAGAAATTTGATGGACCAAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-4844s21c1
Sequence:CCGGCTGGAGAGCAGAGGCTATTTGCTCGAGCAAATAGCCTCTGCTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-1369s21c1
Sequence:CCGGCCTCAACATACGTCCGTATATCTCGAGATATACGGACGTATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_025090.3-1148s21c1
Sequence:CCGGATCCGGCAAGCTGCGAATATTCTCGAGAATATTCGCAGCTTGCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025090.2-1575s1c1
Sequence:CCGGTCCAAGAAGAACATCGGCAATCTCGAGATTGCCGATGTTCTTCTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_025090.2-3363s1c1
Sequence:CCGGGCGGTCAGTCAGGATGCTATTCTCGAGAATAGCATCCTGACTGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025090.2-1888s1c1
Sequence:CCGGGCAACTCGAATAGCAGCAGATCTCGAGATCTGCTGCTATTCGAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025090.2-1272s1c1
Sequence:CCGGCGTCCGTATATGTCCCAGAATCTCGAGATTCTGGGACATATACGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022444    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_025090.2-5809s1c1
Sequence:CCGGGCGACTGAATATACACCTGTACTCGAGTACAGGTGTATATTCAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033528
USP36 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 36
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-1801s21c1
Sequence:CCGGGCGACAAGACTCTGTAATGATCTCGAGATCATTACAGAGTCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-1884s21c1
Sequence:CCGGGCCTGAAGTTACAGAACGGATCTCGAGATCCGTTCTGTAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-2295s21c1
Sequence:CCGGCCTGTGATTCTCAGGGAACAACTCGAGTTGTTCCCTGAGAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-1288s21c1
Sequence:CCGGGAACGCCTATATGTGTGCTAACTCGAGTTAGCACACATATAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-2342s21c1
Sequence:CCGGGCGCTGTTGAATGGAGTAGATCTCGAGATCTACTCCATTCAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033528
USP36 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 36
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-1801s21c1
Sequence:CCGGGCGACAAGACTCTGTAATGATCTCGAGATCATTACAGAGTCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-1884s21c1
Sequence:CCGGGCCTGAAGTTACAGAACGGATCTCGAGATCCGTTCTGTAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-2295s21c1
Sequence:CCGGCCTGTGATTCTCAGGGAACAACTCGAGTTGTTCCCTGAGAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-1288s21c1
Sequence:CCGGGAACGCCTATATGTGTGCTAACTCGAGTTAGCACACATATAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-2342s21c1
Sequence:CCGGGCGCTGTTGAATGGAGTAGATCTCGAGATCTACTCCATTCAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033528
USP36 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 36
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-1801s21c1
Sequence:CCGGGCGACAAGACTCTGTAATGATCTCGAGATCATTACAGAGTCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-1884s21c1
Sequence:CCGGGCCTGAAGTTACAGAACGGATCTCGAGATCCGTTCTGTAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-2295s21c1
Sequence:CCGGCCTGTGATTCTCAGGGAACAACTCGAGTTGTTCCCTGAGAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-1288s21c1
Sequence:CCGGGAACGCCTATATGTGTGCTAACTCGAGTTAGCACACATATAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033528.1-2342s21c1
Sequence:CCGGGCGCTGTTGAATGGAGTAGATCTCGAGATCTACTCCATTCAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_126772
VALIDATED
USP36 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 36
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126772.3-2339s1c1
Sequence:CCGGCCTGTGATTCTCAGGGAACAACTCGAGTTGTTCCCTGAGAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126772.3-1332s1c1
Sequence:CCGGGAACGCCTATATGTGTGCTAACTCGAGTTAGCACACATATAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126772.3-1845s1c1
Sequence:CCGGGCGACAAGACTCTGTAATGATCTCGAGATCATTACAGAGTCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126772.3-1928s1c1
Sequence:CCGGGCCTGAAGTTACAGAACGGATCTCGAGATCCGTTCTGTAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126772.3-2386s1c1
Sequence:CCGGGCGCTGTTGAATGGAGTAGATCTCGAGATCTACTCCATTCAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_126772
VALIDATED
USP36 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 36
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126772.3-2339s1c1
Sequence:CCGGCCTGTGATTCTCAGGGAACAACTCGAGTTGTTCCCTGAGAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126772.3-1332s1c1
Sequence:CCGGGAACGCCTATATGTGTGCTAACTCGAGTTAGCACACATATAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126772.3-1845s1c1
Sequence:CCGGGCGACAAGACTCTGTAATGATCTCGAGATCATTACAGAGTCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126772.3-1928s1c1
Sequence:CCGGGCCTGAAGTTACAGAACGGATCTCGAGATCCGTTCTGTAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126772.3-2386s1c1
Sequence:CCGGGCGCTGTTGAATGGAGTAGATCTCGAGATCTACTCCATTCAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_126772
VALIDATED
USP36 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 36
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126772.3-2339s1c1
Sequence:CCGGCCTGTGATTCTCAGGGAACAACTCGAGTTGTTCCCTGAGAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126772.3-1332s1c1
Sequence:CCGGGAACGCCTATATGTGTGCTAACTCGAGTTAGCACACATATAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126772.3-1845s1c1
Sequence:CCGGGCGACAAGACTCTGTAATGATCTCGAGATCATTACAGAGTCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126772.3-1928s1c1
Sequence:CCGGGCCTGAAGTTACAGAACGGATCTCGAGATCCGTTCTGTAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126772.3-2386s1c1
Sequence:CCGGGCGCTGTTGAATGGAGTAGATCTCGAGATCTACTCCATTCAACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks