EMAIL THIS PAGE TO A FRIEND

USP37

ubiquitin specific peptidase 37

Gene ID:
Mouse(319651) ubiquitin specific peptidase 37
Rat(100361658) ubiquitin specific peptidase 37
Zebrafish(768201) ubiquitin specific peptidase 37
chicken(424216) ubiquitin specific peptidase 37
Horse(100055721) ubiquitin specific peptidase 37
domestic cat(101087769) ubiquitin specific peptidase 37
dog(488523) ubiquitin specific peptidase 37
cow(407168) ubiquitin specific peptidase 37
sheep(101110822) ubiquitin specific peptidase 37
domestic guinea pig(100726363) ubiquitin specific peptidase 37
Domestic Rabbit(100347231) ubiquitin specific peptidase 37
naked mole-rat(101705366) ubiquitin specific peptidase 37
150 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176972 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176972 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176972 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020935 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020935 Rosetta Predictions human pricing
NM_176972 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018875 predicted 560
2 SASI_Hs02_00354323 predicted 647
3 SASI_Hs01_00018876 predicted 2515
4 SASI_Hs01_00018878 predicted 1457
5 SASI_Hs01_00018880 predicted 432
6 SASI_Hs01_00018881 predicted 1254
7 SASI_Hs02_00354324 predicted 1124
8 SASI_Hs01_00018882 predicted 2503
9 SASI_Hs01_00018883 predicted 2462
10 SASI_Hs01_00018884 predicted 2233
11 SASI_Hs01_00018877 predicted 1634
12 SASI_Hs01_00018879 predicted 1975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346886 predicted 2304
2 SASI_Mm01_00131000 predicted 1791
3 SASI_Mm01_00131001 predicted 954
4 SASI_Mm01_00131003 predicted 3195
5 SASI_Mm01_00131004 predicted 1583
6 SASI_Mm01_00131005 predicted 2213
7 SASI_Mm01_00131006 predicted 2358
8 SASI_Mm01_00131007 predicted 763
9 SASI_Mm01_00131008 predicted 1060
10 SASI_Mm01_00131009 predicted 2071
11 SASI_Mm01_00131002 predicted 446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176972
VALIDATED
USP37 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 37
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176972.2-3202s1c1
Sequence:CCGGCGGCTATATCTTCTTCTATATCTCGAGATATAGAAGAAGATATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176972.2-2597s1c1
Sequence:CCGGGCAGAAGATGATATTCCAGAACTCGAGTTCTGGAATATCATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176972.2-2882s1c1
Sequence:CCGGGCTACAGAATTAAGTCTTCAACTCGAGTTGAAGACTTAATTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176972.2-1535s1c1
Sequence:CCGGCGCTTTGCAAACCTGCTTATTCTCGAGAATAAGCAGGTTTGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176972.2-587s1c1
Sequence:CCGGCGCCTAATGTTGACTTTACAACTCGAGTTGTAAAGTCAACATTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176972
VALIDATED
USP37 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 37
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176972.2-3202s1c1
Sequence:CCGGCGGCTATATCTTCTTCTATATCTCGAGATATAGAAGAAGATATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176972.2-2597s1c1
Sequence:CCGGGCAGAAGATGATATTCCAGAACTCGAGTTCTGGAATATCATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176972.2-2882s1c1
Sequence:CCGGGCTACAGAATTAAGTCTTCAACTCGAGTTGAAGACTTAATTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176972.2-1535s1c1
Sequence:CCGGCGCTTTGCAAACCTGCTTATTCTCGAGAATAAGCAGGTTTGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176972.2-587s1c1
Sequence:CCGGCGCCTAATGTTGACTTTACAACTCGAGTTGTAAAGTCAACATTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176972
VALIDATED
USP37 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 37
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176972.2-3202s1c1
Sequence:CCGGCGGCTATATCTTCTTCTATATCTCGAGATATAGAAGAAGATATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176972.2-2597s1c1
Sequence:CCGGGCAGAAGATGATATTCCAGAACTCGAGTTCTGGAATATCATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176972.2-2882s1c1
Sequence:CCGGGCTACAGAATTAAGTCTTCAACTCGAGTTGAAGACTTAATTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176972.2-1535s1c1
Sequence:CCGGCGCTTTGCAAACCTGCTTATTCTCGAGAATAAGCAGGTTTGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176972.2-587s1c1
Sequence:CCGGCGCCTAATGTTGACTTTACAACTCGAGTTGTAAAGTCAACATTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020935
USP37 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 37
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020935.x-3199s1c1
Sequence:CCGGCGGAGTGGCTACATCTTCTTTCTCGAGAAAGAAGATGTAGCCACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020935.x-475s1c1
Sequence:CCGGGAGAATAAAGTCAGCCTAGTACTCGAGTACTAGGCTGACTTTATTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020935.x-7675s1c1
Sequence:CCGGCCCTAACTTCTCTGGCCTATTCTCGAGAATAGGCCAGAGAAGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020935.x-2591s1c1
Sequence:CCGGCCGGATTTGCAGAAGATGATACTCGAGTATCATCTTCTGCAAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020935.x-2884s1c1
Sequence:CCGGGCTACCGAGTTAAGTCTTCAACTCGAGTTGAAGACTTAACTCGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020935.2-612s21c1
Sequence:CCGGGCGAAACAAAGCCGCCTAATGCTCGAGCATTAGGCGGCTTTGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020935.2-1956s21c1
Sequence:CCGGCCACTCCCTCCTCGTTCAATTCTCGAGAATTGAACGAGGAGGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020935.2-3542s21c1
Sequence:CCGGTCACATCCGTAGCTGATTATCCTCGAGGATAATCAGCTACGGATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020935.2-908s21c1
Sequence:CCGGTCCGGGTAGAGGATCGATTAACTCGAGTTAATCGATCCTCTACCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020935
USP37 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 37
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020935.x-3199s1c1
Sequence:CCGGCGGAGTGGCTACATCTTCTTTCTCGAGAAAGAAGATGTAGCCACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020935.x-475s1c1
Sequence:CCGGGAGAATAAAGTCAGCCTAGTACTCGAGTACTAGGCTGACTTTATTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020935.x-7675s1c1
Sequence:CCGGCCCTAACTTCTCTGGCCTATTCTCGAGAATAGGCCAGAGAAGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020935.x-2591s1c1
Sequence:CCGGCCGGATTTGCAGAAGATGATACTCGAGTATCATCTTCTGCAAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020935.x-2884s1c1
Sequence:CCGGGCTACCGAGTTAAGTCTTCAACTCGAGTTGAAGACTTAACTCGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020935.2-612s21c1
Sequence:CCGGGCGAAACAAAGCCGCCTAATGCTCGAGCATTAGGCGGCTTTGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020935.2-1956s21c1
Sequence:CCGGCCACTCCCTCCTCGTTCAATTCTCGAGAATTGAACGAGGAGGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020935.2-3542s21c1
Sequence:CCGGTCACATCCGTAGCTGATTATCCTCGAGGATAATCAGCTACGGATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020935.2-908s21c1
Sequence:CCGGTCCGGGTAGAGGATCGATTAACTCGAGTTAATCGATCCTCTACCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020935
USP37 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 37
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020935.x-3199s1c1
Sequence:CCGGCGGAGTGGCTACATCTTCTTTCTCGAGAAAGAAGATGTAGCCACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020935.x-475s1c1
Sequence:CCGGGAGAATAAAGTCAGCCTAGTACTCGAGTACTAGGCTGACTTTATTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020935.x-7675s1c1
Sequence:CCGGCCCTAACTTCTCTGGCCTATTCTCGAGAATAGGCCAGAGAAGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020935.x-2591s1c1
Sequence:CCGGCCGGATTTGCAGAAGATGATACTCGAGTATCATCTTCTGCAAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020935.x-2884s1c1
Sequence:CCGGGCTACCGAGTTAAGTCTTCAACTCGAGTTGAAGACTTAACTCGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020935.2-612s21c1
Sequence:CCGGGCGAAACAAAGCCGCCTAATGCTCGAGCATTAGGCGGCTTTGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020935.2-1956s21c1
Sequence:CCGGCCACTCCCTCCTCGTTCAATTCTCGAGAATTGAACGAGGAGGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020935.2-3542s21c1
Sequence:CCGGTCACATCCGTAGCTGATTATCCTCGAGGATAATCAGCTACGGATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020935.2-908s21c1
Sequence:CCGGTCCGGGTAGAGGATCGATTAACTCGAGTTAATCGATCCTCTACCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks