EMAIL THIS PAGE TO A FRIEND

USP38

ubiquitin specific peptidase 38

Synonyms: HP43.8KD
UniProtKB ID: Q8NB14, B3KX93, Q8NDF5, Q96DK6, Q96PZ6, Q9BY55
Gene ID:
Mouse(74841) ubiquitin specific peptidase 38
Rat(307764) ubiquitin specific peptidase 38
naked mole-rat(101720887) ubiquitin specific peptidase 38
Domestic Rabbit(100347074) ubiquitin specific peptidase 38
domestic guinea pig(100730769) ubiquitin specific peptidase 38
cow(534262) ubiquitin specific peptidase 38
sheep(101112596) ubiquitin specific peptidase 38
Zebrafish(563778) ubiquitin specific peptidase 38
Horse(100062951) ubiquitin specific peptidase 38
domestic cat(101088743) ubiquitin specific peptidase 38
dog(476071) ubiquitin specific peptidase 38
chicken(422455) ubiquitin specific peptidase 38
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032557 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032557 Rosetta Predictions human pricing
NM_001107418 Rosetta Predictions rat pricing
NM_027554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189218 predicted 3175
2 SASI_Hs02_00360065 predicted 2177
3 SASI_Hs01_00189220 predicted 3073
4 SASI_Hs01_00189222 predicted 3426
5 SASI_Hs02_00360066 predicted 2571
6 SASI_Hs02_00360067 predicted 2168
7 SASI_Hs01_00189224 predicted 2459
8 SASI_Hs01_00189225 predicted 3022
9 SASI_Hs01_00189226 predicted 2846
10 SASI_Hs01_00189227 predicted 2810
11 SASI_Hs01_00189219 predicted 3357
12 SASI_Hs01_00189221 predicted 2648
13 SASI_Hs01_00189223 predicted 1568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107418 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228625 predicted 2662
2 SASI_Rn02_00228626 predicted 2286
3 SASI_Rn02_00228627 predicted 2362
4 SASI_Rn02_00228628 predicted 2651
5 SASI_Rn02_00228629 predicted 2592
6 SASI_Rn02_00228630 predicted 2476
7 SASI_Rn02_00228631 predicted 1811
8 SASI_Rn02_00228632 predicted 1623
9 SASI_Rn02_00228633 predicted 1739
10 SASI_Rn02_00228634 predicted 1730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199431 predicted 3029
2 SASI_Mm01_00199432 predicted 2556
3 SASI_Mm01_00199433 predicted 2986
4 SASI_Mm02_00332394 predicted 1510
5 SASI_Mm02_00332395 predicted 2011
6 SASI_Mm01_00199434 predicted 2421
7 SASI_Mm01_00199436 predicted 1259
8 SASI_Mm01_00199437 predicted 1651
9 SASI_Mm02_00332396 predicted 2211
10 SASI_Mm01_00199440 predicted 915
11 SASI_Mm01_00199435 predicted 1832
12 SASI_Mm01_00199438 predicted 2897
13 SASI_Mm01_00199439 predicted 1581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027554
VALIDATED
USP38 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 38
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027554.2-3501s21c1
Sequence:CCGGCCCAATGGATTTGATGACAATCTCGAGATTGTCATCAAATCCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027554.2-2973s21c1
Sequence:CCGGCCCAAATTAGTGCCCTACCTACTCGAGTAGGTAGGGCACTAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027554.2-1974s21c1
Sequence:CCGGGCTTACGCACCTCGGATATTTCTCGAGAAATATCCGAGGTGCGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027554.2-3668s21c1
Sequence:CCGGGTAACCTATAGCATATCTATCCTCGAGGATAGATATGCTATAGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027554.2-2476s21c1
Sequence:CCGGGCGACTCAGTTGTGAATCAAACTCGAGTTTGATTCACAACTGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027554.2-1322s1c1
Sequence:CCGGGCATGTAGATACGTGGGTAATCTCGAGATTACCCACGTATCTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027554.2-2476s1c1
Sequence:CCGGGCGACTCAGTTGTGAATCAAACTCGAGTTTGATTCACAACTGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027554.2-3501s1c1
Sequence:CCGGCCCAATGGATTTGATGACAATCTCGAGATTGTCATCAAATCCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027554.2-1514s1c1
Sequence:CCGGCCATGTGATTGTCCCTCATATCTCGAGATATGAGGGACAATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027554.2-2973s1c1
Sequence:CCGGCCCAAATTAGTGCCCTACCTACTCGAGTAGGTAGGGCACTAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027554
VALIDATED
USP38 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 38
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027554.2-3501s21c1
Sequence:CCGGCCCAATGGATTTGATGACAATCTCGAGATTGTCATCAAATCCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027554.2-2973s21c1
Sequence:CCGGCCCAAATTAGTGCCCTACCTACTCGAGTAGGTAGGGCACTAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027554.2-1974s21c1
Sequence:CCGGGCTTACGCACCTCGGATATTTCTCGAGAAATATCCGAGGTGCGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027554.2-3668s21c1
Sequence:CCGGGTAACCTATAGCATATCTATCCTCGAGGATAGATATGCTATAGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027554.2-2476s21c1
Sequence:CCGGGCGACTCAGTTGTGAATCAAACTCGAGTTTGATTCACAACTGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027554.2-1322s1c1
Sequence:CCGGGCATGTAGATACGTGGGTAATCTCGAGATTACCCACGTATCTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027554.2-2476s1c1
Sequence:CCGGGCGACTCAGTTGTGAATCAAACTCGAGTTTGATTCACAACTGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027554.2-3501s1c1
Sequence:CCGGCCCAATGGATTTGATGACAATCTCGAGATTGTCATCAAATCCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027554.2-1514s1c1
Sequence:CCGGCCATGTGATTGTCCCTCATATCTCGAGATATGAGGGACAATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027554.2-2973s1c1
Sequence:CCGGCCCAAATTAGTGCCCTACCTACTCGAGTAGGTAGGGCACTAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027554
VALIDATED
USP38 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 38
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027554.2-3501s21c1
Sequence:CCGGCCCAATGGATTTGATGACAATCTCGAGATTGTCATCAAATCCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027554.2-2973s21c1
Sequence:CCGGCCCAAATTAGTGCCCTACCTACTCGAGTAGGTAGGGCACTAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027554.2-1974s21c1
Sequence:CCGGGCTTACGCACCTCGGATATTTCTCGAGAAATATCCGAGGTGCGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027554.2-3668s21c1
Sequence:CCGGGTAACCTATAGCATATCTATCCTCGAGGATAGATATGCTATAGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027554.2-2476s21c1
Sequence:CCGGGCGACTCAGTTGTGAATCAAACTCGAGTTTGATTCACAACTGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027554.2-1322s1c1
Sequence:CCGGGCATGTAGATACGTGGGTAATCTCGAGATTACCCACGTATCTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027554.2-2476s1c1
Sequence:CCGGGCGACTCAGTTGTGAATCAAACTCGAGTTTGATTCACAACTGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027554.2-3501s1c1
Sequence:CCGGCCCAATGGATTTGATGACAATCTCGAGATTGTCATCAAATCCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027554.2-1514s1c1
Sequence:CCGGCCATGTGATTGTCCCTCATATCTCGAGATATGAGGGACAATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027554.2-2973s1c1
Sequence:CCGGCCCAAATTAGTGCCCTACCTACTCGAGTAGGTAGGGCACTAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032557
VALIDATED
USP38 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 38
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032557.5-2716s21c1
Sequence:CCGGCCAGAGATTCTTACTGGTGATCTCGAGATCACCAGTAAGAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032557.5-1635s21c1
Sequence:CCGGGCCTTCAAGTACAGCCTTCTTCTCGAGAAGAAGGCTGTACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032557.5-3698s21c1
Sequence:CCGGCGTCTAATACTATGACTGTTACTCGAGTAACAGTCATAGTATTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032557.5-1219s21c1
Sequence:CCGGGCATCATTTGAACCTTCTGTACTCGAGTACAGAAGGTTCAAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032557.4-3670s1c1
Sequence:CCGGCGTCTAATACTATGACTGTTACTCGAGTAACAGTCATAGTATTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032557.4-1607s1c1
Sequence:CCGGGCCTTCAAGTACAGCCTTCTTCTCGAGAAGAAGGCTGTACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032557.4-1191s1c1
Sequence:CCGGGCATCATTTGAACCTTCTGTACTCGAGTACAGAAGGTTCAAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032557.4-3021s1c1
Sequence:CCGGCCCTATCTATTAAGTTCCGTTCTCGAGAACGGAACTTAATAGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032557.4-2688s1c1
Sequence:CCGGCCAGAGATTCTTACTGGTGATCTCGAGATCACCAGTAAGAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032557
VALIDATED
USP38 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 38
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032557.5-2716s21c1
Sequence:CCGGCCAGAGATTCTTACTGGTGATCTCGAGATCACCAGTAAGAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032557.5-1635s21c1
Sequence:CCGGGCCTTCAAGTACAGCCTTCTTCTCGAGAAGAAGGCTGTACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032557.5-3698s21c1
Sequence:CCGGCGTCTAATACTATGACTGTTACTCGAGTAACAGTCATAGTATTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032557.5-1219s21c1
Sequence:CCGGGCATCATTTGAACCTTCTGTACTCGAGTACAGAAGGTTCAAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032557.4-3670s1c1
Sequence:CCGGCGTCTAATACTATGACTGTTACTCGAGTAACAGTCATAGTATTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032557.4-1607s1c1
Sequence:CCGGGCCTTCAAGTACAGCCTTCTTCTCGAGAAGAAGGCTGTACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032557.4-1191s1c1
Sequence:CCGGGCATCATTTGAACCTTCTGTACTCGAGTACAGAAGGTTCAAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032557.4-3021s1c1
Sequence:CCGGCCCTATCTATTAAGTTCCGTTCTCGAGAACGGAACTTAATAGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032557.4-2688s1c1
Sequence:CCGGCCAGAGATTCTTACTGGTGATCTCGAGATCACCAGTAAGAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032557
VALIDATED
USP38 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 38
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032557.5-2716s21c1
Sequence:CCGGCCAGAGATTCTTACTGGTGATCTCGAGATCACCAGTAAGAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032557.5-1635s21c1
Sequence:CCGGGCCTTCAAGTACAGCCTTCTTCTCGAGAAGAAGGCTGTACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032557.5-3698s21c1
Sequence:CCGGCGTCTAATACTATGACTGTTACTCGAGTAACAGTCATAGTATTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032557.5-1219s21c1
Sequence:CCGGGCATCATTTGAACCTTCTGTACTCGAGTACAGAAGGTTCAAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032557.4-3670s1c1
Sequence:CCGGCGTCTAATACTATGACTGTTACTCGAGTAACAGTCATAGTATTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032557.4-1607s1c1
Sequence:CCGGGCCTTCAAGTACAGCCTTCTTCTCGAGAAGAAGGCTGTACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032557.4-1191s1c1
Sequence:CCGGGCATCATTTGAACCTTCTGTACTCGAGTACAGAAGGTTCAAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032557.4-3021s1c1
Sequence:CCGGCCCTATCTATTAAGTTCCGTTCTCGAGAACGGAACTTAATAGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032557.4-2688s1c1
Sequence:CCGGCCAGAGATTCTTACTGGTGATCTCGAGATCACCAGTAAGAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks