EMAIL THIS PAGE TO A FRIEND

USP39

ubiquitin specific peptidase 39

Synonyms: 65K HSPC332 SAD1 SNRNP65
Gene ID:
Mouse(28035) ubiquitin specific peptidase 39
Rat(297336) ubiquitin specific peptidase 39
Zebrafish(790924) ubiquitin specific peptidase 39
chicken(100859000) ubiquitin specific peptidase 39
dog(475767) ubiquitin specific peptidase 39
domestic cat(101086897) ubiquitin specific peptidase 39
cow(532985) ubiquitin specific peptidase 39
sheep(101103797) ubiquitin specific peptidase 39
domestic guinea pig(100728422) ubiquitin specific peptidase 39
naked mole-rat(101700883) ubiquitin specific peptidase 39
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006590 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006590 Rosetta Predictions human pricing
NM_001106597 Rosetta Predictions rat pricing
NM_138592 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034674 predicted 668
2 SASI_Hs01_00034675 predicted 730
3 SASI_Hs01_00034676 predicted 886
4 SASI_Hs01_00034677 predicted 1055
5 SASI_Hs01_00034678 predicted 702
6 SASI_Hs01_00034679 predicted 304
7 SASI_Hs01_00034680 predicted 936
8 SASI_Hs01_00034681 predicted 605
9 SASI_Hs02_00341897 predicted 1464
10 SASI_Hs01_00034682 predicted 657
11 SASI_Hs01_00034683 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220518 predicted 1432
2 SASI_Rn02_00220519 predicted 665
3 SASI_Rn02_00220520 predicted 1457
4 SASI_Rn02_00220521 predicted 1443
5 SASI_Rn02_00220522 predicted 382
6 SASI_Rn02_00220523 predicted 688
7 SASI_Rn02_00220524 predicted 1380
8 SASI_Rn02_00220525 predicted 1706
9 SASI_Rn02_00220526 predicted 334
10 SASI_Rn02_00220527 predicted 1716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150633 predicted 1449
2 SASI_Mm01_00150634 predicted 284
3 SASI_Mm01_00150635 predicted 1377
4 SASI_Mm01_00150636 predicted 1427
5 SASI_Mm01_00150637 predicted 655
6 SASI_Mm01_00150638 predicted 1044
7 SASI_Mm01_00150639 predicted 1387
8 SASI_Mm01_00150640 predicted 402
9 SASI_Mm01_00150641 predicted 669
10 SASI_Mm01_00150642 predicted 596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138592
VALIDATED
USP39 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 39
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138592.1-1963s1c1
Sequence:CCGGGCCTTATTTGAATTGCTGCAACTCGAGTTGCAGCAATTCAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138592.1-1218s1c1
Sequence:CCGGCCCGCTCTATAAGGATGAGAACTCGAGTTCTCATCCTTATAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138592.1-550s1c1
Sequence:CCGGCCTGACAACTATGAAATCATTCTCGAGAATGATTTCATAGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138592.1-944s1c1
Sequence:CCGGGCAAGAAGACTTTCCAAATTACTCGAGTAATTTGGAAAGTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138592.1-338s1c1
Sequence:CCGGGCCCGTACTTGGATACCATTACTCGAGTAATGGTATCCAAGTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138592.4-1962s21c1
Sequence:CCGGGCCTTATTTGAATTGCTGCAACTCGAGTTGCAGCAATTCAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138592.4-1217s21c1
Sequence:CCGGCCCGCTCTATAAGGATGAGAACTCGAGTTCTCATCCTTATAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138592.4-943s21c1
Sequence:CCGGGCAAGAAGACTTTCCAAATTACTCGAGTAATTTGGAAAGTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138592.4-337s21c1
Sequence:CCGGGCCCGTACTTGGATACCATTACTCGAGTAATGGTATCCAAGTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138592.4-549s21c1
Sequence:CCGGCCTGACAACTATGAAATCATTCTCGAGAATGATTTCATAGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138592
VALIDATED
USP39 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 39
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138592.1-1963s1c1
Sequence:CCGGGCCTTATTTGAATTGCTGCAACTCGAGTTGCAGCAATTCAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138592.1-1218s1c1
Sequence:CCGGCCCGCTCTATAAGGATGAGAACTCGAGTTCTCATCCTTATAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138592.1-550s1c1
Sequence:CCGGCCTGACAACTATGAAATCATTCTCGAGAATGATTTCATAGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138592.1-944s1c1
Sequence:CCGGGCAAGAAGACTTTCCAAATTACTCGAGTAATTTGGAAAGTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138592.1-338s1c1
Sequence:CCGGGCCCGTACTTGGATACCATTACTCGAGTAATGGTATCCAAGTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138592.4-1962s21c1
Sequence:CCGGGCCTTATTTGAATTGCTGCAACTCGAGTTGCAGCAATTCAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138592.4-1217s21c1
Sequence:CCGGCCCGCTCTATAAGGATGAGAACTCGAGTTCTCATCCTTATAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138592.4-943s21c1
Sequence:CCGGGCAAGAAGACTTTCCAAATTACTCGAGTAATTTGGAAAGTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138592.4-337s21c1
Sequence:CCGGGCCCGTACTTGGATACCATTACTCGAGTAATGGTATCCAAGTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138592.4-549s21c1
Sequence:CCGGCCTGACAACTATGAAATCATTCTCGAGAATGATTTCATAGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138592
VALIDATED
USP39 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 39
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138592.1-1963s1c1
Sequence:CCGGGCCTTATTTGAATTGCTGCAACTCGAGTTGCAGCAATTCAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138592.1-1218s1c1
Sequence:CCGGCCCGCTCTATAAGGATGAGAACTCGAGTTCTCATCCTTATAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138592.1-550s1c1
Sequence:CCGGCCTGACAACTATGAAATCATTCTCGAGAATGATTTCATAGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138592.1-944s1c1
Sequence:CCGGGCAAGAAGACTTTCCAAATTACTCGAGTAATTTGGAAAGTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138592.1-338s1c1
Sequence:CCGGGCCCGTACTTGGATACCATTACTCGAGTAATGGTATCCAAGTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138592.4-1962s21c1
Sequence:CCGGGCCTTATTTGAATTGCTGCAACTCGAGTTGCAGCAATTCAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138592.4-1217s21c1
Sequence:CCGGCCCGCTCTATAAGGATGAGAACTCGAGTTCTCATCCTTATAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138592.4-943s21c1
Sequence:CCGGGCAAGAAGACTTTCCAAATTACTCGAGTAATTTGGAAAGTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138592.4-337s21c1
Sequence:CCGGGCCCGTACTTGGATACCATTACTCGAGTAATGGTATCCAAGTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138592.4-549s21c1
Sequence:CCGGCCTGACAACTATGAAATCATTCTCGAGAATGATTTCATAGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006590
VALIDATED
USP39 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 39
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-1651s1c1
Sequence:CCGGGATTTGGAAGAGGCGAGATAACTCGAGTTATCTCGCCTCTTCCAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-688s1c1
Sequence:CCGGCTGAATAACATAAAGGCCAATCTCGAGATTGGCCTTTATGTTATTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-672s1c1
Sequence:CCGGGCCGGGTATTGTGGGACTGAACTCGAGTTCAGTCCCACAATACCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-1344s1c1
Sequence:CCGGGTTGCCTCCATATCTAATCTTCTCGAGAAGATTAGATATGGAGGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-530s1c1
Sequence:CCGGCCTTCCAGACAACTATGAGATCTCGAGATCTCATAGTTGTCTGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006590.2-1766s21c1
Sequence:CCGGTGTGGCTGATGATGGTAAATACTCGAGTATTTACCATCATCAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006590.2-558s21c1
Sequence:CCGGCCTTCCAGACAACTATGAGATCTCGAGATCTCATAGTTGTCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006590.2-351s21c1
Sequence:CCGGCCCGTACCTGGACACCATTAACTCGAGTTAATGGTGTCCAGGTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006590.2-1686s21c1
Sequence:CCGGGATTTGGAAGAGGCGAGATAACTCGAGTTATCTCGCCTCTTCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006590.2-1371s21c1
Sequence:CCGGGTTGCCTCCATATCTAATCTTCTCGAGAAGATTAGATATGGAGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006590
VALIDATED
USP39 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 39
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-1651s1c1
Sequence:CCGGGATTTGGAAGAGGCGAGATAACTCGAGTTATCTCGCCTCTTCCAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-688s1c1
Sequence:CCGGCTGAATAACATAAAGGCCAATCTCGAGATTGGCCTTTATGTTATTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-672s1c1
Sequence:CCGGGCCGGGTATTGTGGGACTGAACTCGAGTTCAGTCCCACAATACCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-1344s1c1
Sequence:CCGGGTTGCCTCCATATCTAATCTTCTCGAGAAGATTAGATATGGAGGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-530s1c1
Sequence:CCGGCCTTCCAGACAACTATGAGATCTCGAGATCTCATAGTTGTCTGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006590.2-1766s21c1
Sequence:CCGGTGTGGCTGATGATGGTAAATACTCGAGTATTTACCATCATCAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006590.2-558s21c1
Sequence:CCGGCCTTCCAGACAACTATGAGATCTCGAGATCTCATAGTTGTCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006590.2-351s21c1
Sequence:CCGGCCCGTACCTGGACACCATTAACTCGAGTTAATGGTGTCCAGGTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006590.2-1686s21c1
Sequence:CCGGGATTTGGAAGAGGCGAGATAACTCGAGTTATCTCGCCTCTTCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006590.2-1371s21c1
Sequence:CCGGGTTGCCTCCATATCTAATCTTCTCGAGAAGATTAGATATGGAGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006590
VALIDATED
USP39 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 39
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-1651s1c1
Sequence:CCGGGATTTGGAAGAGGCGAGATAACTCGAGTTATCTCGCCTCTTCCAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-688s1c1
Sequence:CCGGCTGAATAACATAAAGGCCAATCTCGAGATTGGCCTTTATGTTATTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-672s1c1
Sequence:CCGGGCCGGGTATTGTGGGACTGAACTCGAGTTCAGTCCCACAATACCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-1344s1c1
Sequence:CCGGGTTGCCTCCATATCTAATCTTCTCGAGAAGATTAGATATGGAGGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006590.x-530s1c1
Sequence:CCGGCCTTCCAGACAACTATGAGATCTCGAGATCTCATAGTTGTCTGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006590.2-1766s21c1
Sequence:CCGGTGTGGCTGATGATGGTAAATACTCGAGTATTTACCATCATCAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006590.2-558s21c1
Sequence:CCGGCCTTCCAGACAACTATGAGATCTCGAGATCTCATAGTTGTCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006590.2-351s21c1
Sequence:CCGGCCCGTACCTGGACACCATTAACTCGAGTTAATGGTGTCCAGGTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006590.2-1686s21c1
Sequence:CCGGGATTTGGAAGAGGCGAGATAACTCGAGTTATCTCGCCTCTTCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006590.2-1371s21c1
Sequence:CCGGGTTGCCTCCATATCTAATCTTCTCGAGAAGATTAGATATGGAGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks