EMAIL THIS PAGE TO A FRIEND

USP3

ubiquitin specific peptidase 3

Synonyms: SIH003 UBP
UniProtKB ID: Q9Y6I4, B4DVU5, F5H1A6, Q8WVD0
Gene ID:
Mouse(235441) ubiquitin specific peptidase 3
Rat(363084) ubiquitin specific peptidase 3
Zebrafish(569679) ubiquitin specific peptidase 3
Horse(100067159) ubiquitin specific peptidase 3
domestic cat(101090268) ubiquitin specific peptidase 3
dog(487590) ubiquitin specific peptidase 3
chicken(415369) ubiquitin specific peptidase 3
cow(529395) ubiquitin specific peptidase 3
sheep(101110846) ubiquitin specific peptidase 3
domestic guinea pig(100713780) ubiquitin specific peptidase 3
naked mole-rat(101709057) ubiquitin specific peptidase 3
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006537 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006537 Rosetta Predictions human pricing
NM_001025424 Rosetta Predictions rat pricing
NM_144937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023593 predicted 1669
2 SASI_Hs01_00023595 predicted 1537
3 SASI_Hs01_00023596 predicted 457
4 SASI_Hs01_00023598 predicted 1583
5 SASI_Hs01_00023599 predicted 372
6 SASI_Hs01_00023601 predicted 277
7 SASI_Hs01_00023602 predicted 997
8 SASI_Hs02_00341788 predicted 373
9 SASI_Hs02_00341789 predicted 655
10 SASI_Hs02_00341790 predicted 967
11 SASI_Hs01_00023594 predicted 552
12 SASI_Hs01_00023597 predicted 252
13 SASI_Hs01_00023600 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025424 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035815 predicted 385
2 SASI_Rn01_00035817 predicted 1365
3 SASI_Rn02_00203171 predicted 229
4 SASI_Rn01_00035819 predicted 1022
5 SASI_Rn01_00035820 predicted 1676
6 SASI_Rn01_00035821 predicted 440
7 SASI_Rn02_00203172 predicted 261
8 SASI_Rn01_00035822 predicted 1339
9 SASI_Rn01_00035823 predicted 1713
10 SASI_Rn01_00035824 predicted 1203
11 SASI_Rn01_00035816 predicted 557
12 SASI_Rn01_00035818 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055363 predicted 743
2 SASI_Mm01_00055364 predicted 333
3 SASI_Mm01_00055365 predicted 382
4 SASI_Mm02_00340462 predicted 225
5 SASI_Mm01_00055367 predicted 439
6 SASI_Mm01_00055369 predicted 257
7 SASI_Mm01_00055370 predicted 1338
8 SASI_Mm01_00055371 predicted 585
9 SASI_Mm01_00055372 predicted 341
10 SASI_Mm02_00340463 predicted 630
11 SASI_Mm01_00055366 predicted 1242
12 SASI_Mm01_00055368 predicted 1028
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144937
USP3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144937.3-1691s21c1
Sequence:CCGGCAACTACACCGGACAACATTTCTCGAGAAATGTTGTCCGGTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144937.3-1375s21c1
Sequence:CCGGAGTCGATACATACGTTCAATTCTCGAGAATTGAACGTATGTATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144937.3-577s21c1
Sequence:CCGGTGCCACAGGCCTTCGAAATTTCTCGAGAAATTTCGAAGGCCTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144937.3-1409s21c1
Sequence:CCGGCTGGACATGAAGTGCTACCTACTCGAGTAGGTAGCACTTCATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144937.3-1345s21c1
Sequence:CCGGGTTTCACTGGACAGCATATTTCTCGAGAAATATGCTGTCCAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-1409s1c1
Sequence:CCGGCTGGACATGAAGTGCTACCTACTCGAGTAGGTAGCACTTCATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-306s1c1
Sequence:CCGGCCTTACTCAACCATAAGAGATCTCGAGATCTCTTATGGTTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-995s1c1
Sequence:CCGGGCAAGTAACAAATGCTGCATACTCGAGTATGCAGCATTTGTTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-1245s1c1
Sequence:CCGGCAGAGTTGTATATGTGCCATACTCGAGTATGGCACATATACAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-752s1c1
Sequence:CCGGGTGTCTTTAGTAGAAGAGTTTCTCGAGAAACTCTTCTACTAAAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144937
USP3 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144937.3-1691s21c1
Sequence:CCGGCAACTACACCGGACAACATTTCTCGAGAAATGTTGTCCGGTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144937.3-1375s21c1
Sequence:CCGGAGTCGATACATACGTTCAATTCTCGAGAATTGAACGTATGTATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144937.3-577s21c1
Sequence:CCGGTGCCACAGGCCTTCGAAATTTCTCGAGAAATTTCGAAGGCCTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144937.3-1409s21c1
Sequence:CCGGCTGGACATGAAGTGCTACCTACTCGAGTAGGTAGCACTTCATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144937.3-1345s21c1
Sequence:CCGGGTTTCACTGGACAGCATATTTCTCGAGAAATATGCTGTCCAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-1409s1c1
Sequence:CCGGCTGGACATGAAGTGCTACCTACTCGAGTAGGTAGCACTTCATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-306s1c1
Sequence:CCGGCCTTACTCAACCATAAGAGATCTCGAGATCTCTTATGGTTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-995s1c1
Sequence:CCGGGCAAGTAACAAATGCTGCATACTCGAGTATGCAGCATTTGTTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-1245s1c1
Sequence:CCGGCAGAGTTGTATATGTGCCATACTCGAGTATGGCACATATACAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-752s1c1
Sequence:CCGGGTGTCTTTAGTAGAAGAGTTTCTCGAGAAACTCTTCTACTAAAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144937
USP3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144937.3-1691s21c1
Sequence:CCGGCAACTACACCGGACAACATTTCTCGAGAAATGTTGTCCGGTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144937.3-1375s21c1
Sequence:CCGGAGTCGATACATACGTTCAATTCTCGAGAATTGAACGTATGTATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144937.3-577s21c1
Sequence:CCGGTGCCACAGGCCTTCGAAATTTCTCGAGAAATTTCGAAGGCCTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144937.3-1409s21c1
Sequence:CCGGCTGGACATGAAGTGCTACCTACTCGAGTAGGTAGCACTTCATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144937.3-1345s21c1
Sequence:CCGGGTTTCACTGGACAGCATATTTCTCGAGAAATATGCTGTCCAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-1409s1c1
Sequence:CCGGCTGGACATGAAGTGCTACCTACTCGAGTAGGTAGCACTTCATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-306s1c1
Sequence:CCGGCCTTACTCAACCATAAGAGATCTCGAGATCTCTTATGGTTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-995s1c1
Sequence:CCGGGCAAGTAACAAATGCTGCATACTCGAGTATGCAGCATTTGTTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-1245s1c1
Sequence:CCGGCAGAGTTGTATATGTGCCATACTCGAGTATGGCACATATACAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144937.2-752s1c1
Sequence:CCGGGTGTCTTTAGTAGAAGAGTTTCTCGAGAAACTCTTCTACTAAAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006537
VALIDATED
USP3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006537.2-1050s21c1
Sequence:CCGGTACTGTTGTCACGGCTATATTCTCGAGAATATAGCCGTGACAACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006537.2-335s21c1
Sequence:CCGGCCAACCATAAGAAATCAGAAACTCGAGTTTCTGATTTCTTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006537.2-1399s21c1
Sequence:CCGGGTTGATACATACGTAGAATTTCTCGAGAAATTCTACGTATGTATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006537.2-2085s21c1
Sequence:CCGGGCTGCCTTTCCACAGCTATAACTCGAGTTATAGCTGTGGAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006537.2-1100s21c1
Sequence:CCGGGCCTCATATGTGGGACAGAATCTCGAGATTCTGTCCCACATATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006537.1-2053s1c1
Sequence:CCGGGCTGCCTTTCCACAGCTATAACTCGAGTTATAGCTGTGGAAAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006537.1-299s1c1
Sequence:CCGGCCAACCATAAGAAATCAGAAACTCGAGTTTCTGATTTCTTATGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006537.1-1067s1c1
Sequence:CCGGGCCTCATATGTGGGACAGAATCTCGAGATTCTGTCCCACATATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006537.1-874s1c1
Sequence:CCGGGCCCATGAATTCAATGCGCTACTCGAGTAGCGCATTGAATTCATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006537
VALIDATED
USP3 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006537.2-1050s21c1
Sequence:CCGGTACTGTTGTCACGGCTATATTCTCGAGAATATAGCCGTGACAACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006537.2-335s21c1
Sequence:CCGGCCAACCATAAGAAATCAGAAACTCGAGTTTCTGATTTCTTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006537.2-1399s21c1
Sequence:CCGGGTTGATACATACGTAGAATTTCTCGAGAAATTCTACGTATGTATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006537.2-2085s21c1
Sequence:CCGGGCTGCCTTTCCACAGCTATAACTCGAGTTATAGCTGTGGAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006537.2-1100s21c1
Sequence:CCGGGCCTCATATGTGGGACAGAATCTCGAGATTCTGTCCCACATATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006537.1-2053s1c1
Sequence:CCGGGCTGCCTTTCCACAGCTATAACTCGAGTTATAGCTGTGGAAAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006537.1-299s1c1
Sequence:CCGGCCAACCATAAGAAATCAGAAACTCGAGTTTCTGATTTCTTATGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006537.1-1067s1c1
Sequence:CCGGGCCTCATATGTGGGACAGAATCTCGAGATTCTGTCCCACATATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006537.1-874s1c1
Sequence:CCGGGCCCATGAATTCAATGCGCTACTCGAGTAGCGCATTGAATTCATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006537
VALIDATED
USP3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006537.2-1050s21c1
Sequence:CCGGTACTGTTGTCACGGCTATATTCTCGAGAATATAGCCGTGACAACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006537.2-335s21c1
Sequence:CCGGCCAACCATAAGAAATCAGAAACTCGAGTTTCTGATTTCTTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006537.2-1399s21c1
Sequence:CCGGGTTGATACATACGTAGAATTTCTCGAGAAATTCTACGTATGTATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006537.2-2085s21c1
Sequence:CCGGGCTGCCTTTCCACAGCTATAACTCGAGTTATAGCTGTGGAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006537.2-1100s21c1
Sequence:CCGGGCCTCATATGTGGGACAGAATCTCGAGATTCTGTCCCACATATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006537.1-2053s1c1
Sequence:CCGGGCTGCCTTTCCACAGCTATAACTCGAGTTATAGCTGTGGAAAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006537.1-299s1c1
Sequence:CCGGCCAACCATAAGAAATCAGAAACTCGAGTTTCTGATTTCTTATGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006537.1-1067s1c1
Sequence:CCGGGCCTCATATGTGGGACAGAATCTCGAGATTCTGTCCCACATATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006537.1-874s1c1
Sequence:CCGGGCCCATGAATTCAATGCGCTACTCGAGTAGCGCATTGAATTCATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks