EMAIL THIS PAGE TO A FRIEND

USP40

ubiquitin specific peptidase 40

UniProtKB ID: Q9NVE5, Q6NX38, Q70EL0
Gene ID:
Human(55230) Summary: Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP40 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]
Mouse(227334) ubiquitin specific peptidase 40
Rat(316599) ubiquitin specific peptidase 40
Zebrafish(402834) ubiquitin specific peptidase 40
Horse(100065074) ubiquitin specific peptidase 40
domestic cat(101085652) ubiquitin specific peptidase 40
dog(486168) ubiquitin specific peptidase 40
chicken(100859211) ubiquitin carboxyl-terminal hydrolase 40
cow(531139) ubiquitin specific peptidase 40
sheep(101104791) ubiquitin specific peptidase 40
domestic guinea pig(100721912) ubiquitin specific peptidase 40
Domestic Rabbit(100345891) ubiquitin specific peptidase 40
naked mole-rat(101718551) ubiquitin specific peptidase 40
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_129956 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129956 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129956 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018218 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018218 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018218 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018218 Rosetta Predictions human pricing
NM_001134885 Rosetta Predictions rat pricing
XM_001065510 Rosetta Predictions rat pricing
NM_001033291 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145783 predicted 2746
2 SASI_Hs02_00351527 predicted 2025
3 SASI_Hs01_00145784 predicted 1854
4 SASI_Hs01_00145785 predicted 1742
5 SASI_Hs01_00145786 predicted 2353
6 SASI_Hs01_00145787 predicted 303
7 SASI_Hs01_00145790 predicted 843
8 SASI_Hs01_00145792 predicted 1416
9 SASI_Hs02_00351528 predicted 1773
10 SASI_Hs02_00351529 predicted 590
11 SASI_Hs01_00145788 predicted 703
12 SASI_Hs01_00145789 predicted 1186
13 SASI_Hs01_00145791 predicted 2249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258974 predicted 2766
2 SASI_Rn02_00258975 predicted 3487
3 SASI_Rn02_00258976 predicted 527
4 SASI_Rn02_00258977 predicted 1816
5 SASI_Rn02_00258978 predicted 1176
6 SASI_Rn02_00258979 predicted 2454
7 SASI_Rn02_00258980 predicted 951
8 SASI_Rn02_00258981 predicted 2097
9 SASI_Rn02_00258982 predicted 1108
10 SASI_Rn02_00258983 predicted 2357
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314437 predicted 2776
2 SASI_Rn02_00314438 predicted 3502
3 SASI_Rn02_00314439 predicted 531
4 SASI_Rn02_00314440 predicted 1828
5 SASI_Rn02_00314441 predicted 1185
6 SASI_Rn02_00314442 predicted 2464
7 SASI_Rn02_00314443 predicted 954
8 SASI_Rn02_00314444 predicted 2115
9 SASI_Rn02_00314445 predicted 1116
10 SASI_Rn02_00314446 predicted 2362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288491 predicted 547
2 SASI_Mm01_00159357 predicted 2456
3 SASI_Mm01_00159358 predicted 224
4 SASI_Mm01_00159359 predicted 1845
5 SASI_Mm01_00159360 predicted 2640
6 SASI_Mm02_00288492 predicted 1683
7 SASI_Mm01_00159362 predicted 1831
8 SASI_Mm01_00159363 predicted 1030
9 SASI_Mm01_00159364 predicted 2373
10 SASI_Mm01_00159365 predicted 1133
11 SASI_Mm01_00159361 predicted 1612
12 SASI_Mm01_00159366 predicted 1987
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129956
VALIDATED
USP40 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 40
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129956.2-1334s1c1
Sequence:CCGGGCACAGATGAAAGTACAGTTACTCGAGTAACTGTACTTTCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129956.2-3516s1c1
Sequence:CCGGGCTTCCAATATCTAGCTGGAACTCGAGTTCCAGCTAGATATTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129956.2-801s1c1
Sequence:CCGGCCGACTGGTTAAAGCAGCAAACTCGAGTTTGCTGCTTTAACCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129956.2-2047s1c1
Sequence:CCGGCCTCTGCTGTTAAACATTCTTCTCGAGAAGAATGTTTAACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129956.2-1198s1c1
Sequence:CCGGGCCAATCAAATTCCTGTTGATCTCGAGATCAACAGGAATTTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129956
VALIDATED
USP40 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 40
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129956.2-1334s1c1
Sequence:CCGGGCACAGATGAAAGTACAGTTACTCGAGTAACTGTACTTTCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129956.2-3516s1c1
Sequence:CCGGGCTTCCAATATCTAGCTGGAACTCGAGTTCCAGCTAGATATTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129956.2-801s1c1
Sequence:CCGGCCGACTGGTTAAAGCAGCAAACTCGAGTTTGCTGCTTTAACCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129956.2-2047s1c1
Sequence:CCGGCCTCTGCTGTTAAACATTCTTCTCGAGAAGAATGTTTAACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129956.2-1198s1c1
Sequence:CCGGGCCAATCAAATTCCTGTTGATCTCGAGATCAACAGGAATTTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129956
VALIDATED
USP40 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 40
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129956.2-1334s1c1
Sequence:CCGGGCACAGATGAAAGTACAGTTACTCGAGTAACTGTACTTTCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129956.2-3516s1c1
Sequence:CCGGGCTTCCAATATCTAGCTGGAACTCGAGTTCCAGCTAGATATTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129956.2-801s1c1
Sequence:CCGGCCGACTGGTTAAAGCAGCAAACTCGAGTTTGCTGCTTTAACCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129956.2-2047s1c1
Sequence:CCGGCCTCTGCTGTTAAACATTCTTCTCGAGAAGAATGTTTAACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129956.2-1198s1c1
Sequence:CCGGGCCAATCAAATTCCTGTTGATCTCGAGATCAACAGGAATTTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018218
VALIDATED
USP40 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 40
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018218.1-3373s1c1
Sequence:CCGGCCCGTGGAGAAGATTGAAATTCTCGAGAATTTCAATCTTCTCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018218.1-942s1c1
Sequence:CCGGCGGAGGCCATTACCATGTATACTCGAGTATACATGGTAATGGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018218.1-1639s1c1
Sequence:CCGGCCTCAGTATCATTTCTTCAATCTCGAGATTGAAGAAATGATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018218.1-844s1c1
Sequence:CCGGCGGATTAATCTCAAGCCCTTTCTCGAGAAAGGGCTTGAGATTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018218.1-3516s1c1
Sequence:CCGGCGGAGATACTATTGGTGTTAACTCGAGTTAACACCAATAGTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_018218.2-3373s21c1
Sequence:CCGGCCCGTGGAGAAGATTGAAATTCTCGAGAATTTCAATCTTCTCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018218.2-2361s21c1
Sequence:CCGGGGTGTTTGATATTCGAATTAACTCGAGTTAATTCGAATATCAAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018218.2-942s21c1
Sequence:CCGGCGGAGGCCATTACCATGTATACTCGAGTATACATGGTAATGGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018218.2-844s21c1
Sequence:CCGGCGGATTAATCTCAAGCCCTTTCTCGAGAAAGGGCTTGAGATTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018218
VALIDATED
USP40 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 40
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018218.1-3373s1c1
Sequence:CCGGCCCGTGGAGAAGATTGAAATTCTCGAGAATTTCAATCTTCTCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018218.1-942s1c1
Sequence:CCGGCGGAGGCCATTACCATGTATACTCGAGTATACATGGTAATGGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018218.1-1639s1c1
Sequence:CCGGCCTCAGTATCATTTCTTCAATCTCGAGATTGAAGAAATGATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018218.1-844s1c1
Sequence:CCGGCGGATTAATCTCAAGCCCTTTCTCGAGAAAGGGCTTGAGATTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018218.1-3516s1c1
Sequence:CCGGCGGAGATACTATTGGTGTTAACTCGAGTTAACACCAATAGTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_018218.2-3373s21c1
Sequence:CCGGCCCGTGGAGAAGATTGAAATTCTCGAGAATTTCAATCTTCTCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018218.2-2361s21c1
Sequence:CCGGGGTGTTTGATATTCGAATTAACTCGAGTTAATTCGAATATCAAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018218.2-942s21c1
Sequence:CCGGCGGAGGCCATTACCATGTATACTCGAGTATACATGGTAATGGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018218.2-844s21c1
Sequence:CCGGCGGATTAATCTCAAGCCCTTTCTCGAGAAAGGGCTTGAGATTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018218
VALIDATED
USP40 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 40
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018218.1-3373s1c1
Sequence:CCGGCCCGTGGAGAAGATTGAAATTCTCGAGAATTTCAATCTTCTCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018218.1-942s1c1
Sequence:CCGGCGGAGGCCATTACCATGTATACTCGAGTATACATGGTAATGGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018218.1-1639s1c1
Sequence:CCGGCCTCAGTATCATTTCTTCAATCTCGAGATTGAAGAAATGATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018218.1-844s1c1
Sequence:CCGGCGGATTAATCTCAAGCCCTTTCTCGAGAAAGGGCTTGAGATTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018218.1-3516s1c1
Sequence:CCGGCGGAGATACTATTGGTGTTAACTCGAGTTAACACCAATAGTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_018218.2-3373s21c1
Sequence:CCGGCCCGTGGAGAAGATTGAAATTCTCGAGAATTTCAATCTTCTCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018218.2-2361s21c1
Sequence:CCGGGGTGTTTGATATTCGAATTAACTCGAGTTAATTCGAATATCAAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018218.2-942s21c1
Sequence:CCGGCGGAGGCCATTACCATGTATACTCGAGTATACATGGTAATGGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018218.2-844s21c1
Sequence:CCGGCGGATTAATCTCAAGCCCTTTCTCGAGAAAGGGCTTGAGATTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks