EMAIL THIS PAGE TO A FRIEND

USP42

ubiquitin specific peptidase 42

UniProtKB ID: Q9H9J4, A2RUE3, B5MDA5, Q0VIN8, Q3C166, Q6P9B4
Gene ID:
Mouse(76800) ubiquitin specific peptidase 42
Rat(288482) ubiquitin specific peptidase 42
Zebrafish(327528) ubiquitin specific peptidase 42
Horse(100062198) ubiquitin specific peptidase 42
domestic cat(101080852) ubiquitin specific peptidase 42
dog(479754) ubiquitin specific peptidase 42
chicken(416431) ubiquitin specific peptidase 42
naked mole-rat(101708728) ubiquitin specific peptidase 42
domestic guinea pig(100717369) ubiquitin specific peptidase 42
cow(532721) ubiquitin specific peptidase 42
sheep(101105129) ubiquitin specific peptidase 42
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032172 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032172 Rosetta Predictions human pricing
XM_927597 Rosetta Predictions human pricing
XM_932190 Rosetta Predictions human pricing
XM_932196 Rosetta Predictions human pricing
NM_001105909 Rosetta Predictions rat pricing
NM_029749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078970 predicted 1810
2 SASI_Hs01_00078971 predicted 1637
3 SASI_Hs01_00078972 predicted 1889
4 SASI_Hs01_00078973 predicted 1505
5 SASI_Hs01_00078974 predicted 825
6 SASI_Hs01_00078976 predicted 1015
7 SASI_Hs01_00078977 predicted 818
8 SASI_Hs01_00078978 predicted 1727
9 SASI_Hs02_00359434 predicted 1787
10 SASI_Hs01_00078979 predicted 2571
11 SASI_Hs01_00078975 predicted 1582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291532 predicted 1812
2 SASI_Hs01_00291533 predicted 1640
3 SASI_Hs01_00291534 predicted 1889
4 SASI_Hs01_00291535 predicted 1504
5 SASI_Hs01_00291536 predicted 826
6 SASI_Hs01_00291537 predicted 1603
7 SASI_Hs01_00291538 predicted 1014
8 SASI_Hs01_00291539 predicted 810
9 SASI_Hs01_00291540 predicted 1728
10 SASI_Hs01_00291541 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296404 predicted 375
2 SASI_Hs01_00296405 predicted 418
3 SASI_Hs01_00296406 predicted 306
4 SASI_Hs01_00296407 predicted 414
5 SASI_Hs01_00296408 predicted 295
6 SASI_Hs01_00296409 predicted 279
7 SASI_Hs01_00296410 predicted 437
8 SASI_Hs01_00296411 predicted 448
9 SASI_Hs01_00296412 predicted 296
10 SASI_Hs01_00296413 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248233 predicted 1644
2 SASI_Hs01_00248234 predicted 1475
3 SASI_Hs01_00248235 predicted 1728
4 SASI_Hs01_00248236 predicted 1342
5 SASI_Hs01_00248237 predicted 662
6 SASI_Hs01_00248238 predicted 1433
7 SASI_Hs01_00248239 predicted 856
8 SASI_Hs01_00248240 predicted 646
9 SASI_Hs01_00248241 predicted 1568
10 SASI_Hs01_00248242 predicted 1623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213732 predicted 3183
2 SASI_Rn02_00213733 predicted 1004
3 SASI_Rn02_00213734 predicted 2408
4 SASI_Rn02_00213735 predicted 1571
5 SASI_Rn02_00213736 predicted 2810
6 SASI_Rn02_00213737 predicted 305
7 SASI_Rn02_00213738 predicted 537
8 SASI_Rn02_00213739 predicted 471
9 SASI_Rn02_00213740 predicted 455
10 SASI_Rn02_00213741 predicted 1946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167610 predicted 1157
2 SASI_Mm01_00167611 predicted 826
3 SASI_Mm01_00167612 predicted 1298
4 SASI_Mm01_00167613 predicted 2080
5 SASI_Mm01_00167614 predicted 2259
6 SASI_Mm01_00167615 predicted 1037
7 SASI_Mm01_00167616 predicted 3320
8 SASI_Mm01_00167617 predicted 667
9 SASI_Mm01_00167618 predicted 2470
10 SASI_Mm02_00335854 predicted 1097
11 SASI_Mm01_00167619 predicted 2287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032172
VALIDATED
USP42 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 42
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032172.2-1135s21c1
Sequence:CCGGCTTGATATTCGGCCATATATGCTCGAGCATATATGGCCGAATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032172.2-661s21c1
Sequence:CCGGATCAATGAGATGCGGCGTATACTCGAGTATACGCCGCATCTCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032172.2-2087s21c1
Sequence:CCGGTGACCCTAAACGGTGCTAATACTCGAGTATTAGCACCGTTTAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032172.2-314s21c1
Sequence:CCGGCGAGTTCATCTGTACCTGATACTCGAGTATCAGGTACAGATGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032172.2-4360s21c1
Sequence:CCGGCATCTCAAATGCTGCTTAATTCTCGAGAATTAAGCAGCATTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032172.1-288s1c1
Sequence:CCGGCGAGTTCATCTGTACCTGATACTCGAGTATCAGGTACAGATGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032172.1-4754s1c1
Sequence:CCGGCGTCTCTTGTCTTCACTGATACTCGAGTATCAGTGAAGACAAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032172.1-1870s1c1
Sequence:CCGGCGTGATGAATGGCAAATCCAACTCGAGTTGGATTTGCCATTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_032172.1-3981s1c1
Sequence:CCGGCGAAACACTTACGGATGGAAACTCGAGTTTCCATCCGTAAGTGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032172.1-1965s1c1
Sequence:CCGGGCAAGGAGAATGGGATTGGTACTCGAGTACCAATCCCATTCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156541    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032172.1-4753s1c1
Sequence:CCGGGCGTCTCTTGTCTTCACTGATCTCGAGATCAGTGAAGACAAGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032172.1-3542s1c1
Sequence:CCGGGATCGGTTTCACGAACACGAACTCGAGTTCGTGTTCGTGAAACCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032172
VALIDATED
USP42 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 42
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032172.2-1135s21c1
Sequence:CCGGCTTGATATTCGGCCATATATGCTCGAGCATATATGGCCGAATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032172.2-661s21c1
Sequence:CCGGATCAATGAGATGCGGCGTATACTCGAGTATACGCCGCATCTCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032172.2-2087s21c1
Sequence:CCGGTGACCCTAAACGGTGCTAATACTCGAGTATTAGCACCGTTTAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032172.2-314s21c1
Sequence:CCGGCGAGTTCATCTGTACCTGATACTCGAGTATCAGGTACAGATGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032172.2-4360s21c1
Sequence:CCGGCATCTCAAATGCTGCTTAATTCTCGAGAATTAAGCAGCATTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032172.1-288s1c1
Sequence:CCGGCGAGTTCATCTGTACCTGATACTCGAGTATCAGGTACAGATGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032172.1-4754s1c1
Sequence:CCGGCGTCTCTTGTCTTCACTGATACTCGAGTATCAGTGAAGACAAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032172.1-1870s1c1
Sequence:CCGGCGTGATGAATGGCAAATCCAACTCGAGTTGGATTTGCCATTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_032172.1-3981s1c1
Sequence:CCGGCGAAACACTTACGGATGGAAACTCGAGTTTCCATCCGTAAGTGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032172.1-1965s1c1
Sequence:CCGGGCAAGGAGAATGGGATTGGTACTCGAGTACCAATCCCATTCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156541    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032172.1-4753s1c1
Sequence:CCGGGCGTCTCTTGTCTTCACTGATCTCGAGATCAGTGAAGACAAGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032172.1-3542s1c1
Sequence:CCGGGATCGGTTTCACGAACACGAACTCGAGTTCGTGTTCGTGAAACCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032172
VALIDATED
USP42 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 42
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032172.2-1135s21c1
Sequence:CCGGCTTGATATTCGGCCATATATGCTCGAGCATATATGGCCGAATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032172.2-661s21c1
Sequence:CCGGATCAATGAGATGCGGCGTATACTCGAGTATACGCCGCATCTCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032172.2-2087s21c1
Sequence:CCGGTGACCCTAAACGGTGCTAATACTCGAGTATTAGCACCGTTTAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032172.2-314s21c1
Sequence:CCGGCGAGTTCATCTGTACCTGATACTCGAGTATCAGGTACAGATGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032172.2-4360s21c1
Sequence:CCGGCATCTCAAATGCTGCTTAATTCTCGAGAATTAAGCAGCATTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032172.1-288s1c1
Sequence:CCGGCGAGTTCATCTGTACCTGATACTCGAGTATCAGGTACAGATGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032172.1-4754s1c1
Sequence:CCGGCGTCTCTTGTCTTCACTGATACTCGAGTATCAGTGAAGACAAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032172.1-1870s1c1
Sequence:CCGGCGTGATGAATGGCAAATCCAACTCGAGTTGGATTTGCCATTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_032172.1-3981s1c1
Sequence:CCGGCGAAACACTTACGGATGGAAACTCGAGTTTCCATCCGTAAGTGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032172.1-1965s1c1
Sequence:CCGGGCAAGGAGAATGGGATTGGTACTCGAGTACCAATCCCATTCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156541    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032172.1-4753s1c1
Sequence:CCGGGCGTCTCTTGTCTTCACTGATCTCGAGATCAGTGAAGACAAGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032172.1-3542s1c1
Sequence:CCGGGATCGGTTTCACGAACACGAACTCGAGTTCGTGTTCGTGAAACCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029749
USP42 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 42
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029749.2-899s1c1
Sequence:CCGGGACATAACGTTGGAGATTAAGCTCGAGCTTAATCTCCAACGTTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029749.2-1163s1c1
Sequence:CCGGCCCAATGGAGAGCCAATTATTCTCGAGAATAATTGGCTCTCCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029749.1-3579s1c1
Sequence:CCGGCGGAGGTATGAGACTCTAGAACTCGAGTTCTAGAGTCTCATACCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029749.1-4257s1c1
Sequence:CCGGCCTTATTCCAAACGGATACTTCTCGAGAAGTATCCGTTTGGAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029749.1-2024s1c1
Sequence:CCGGCGTCCTGCTAAATGGTGCTAACTCGAGTTAGCACCATTTAGCAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029749.1-2582s1c1
Sequence:CCGGGAAAGGTGATACAGCTGAGAACTCGAGTTCTCAGCTGTATCACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029749.1-775s1c1
Sequence:CCGGGCTACCTAAGATCCCGAGTTACTCGAGTAACTCGGGATCTTAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029749.1-4159s1c1
Sequence:CCGGGCTTCTTTAGTACATACTGTACTCGAGTACAGTATGTACTAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029749
USP42 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 42
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029749.2-899s1c1
Sequence:CCGGGACATAACGTTGGAGATTAAGCTCGAGCTTAATCTCCAACGTTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029749.2-1163s1c1
Sequence:CCGGCCCAATGGAGAGCCAATTATTCTCGAGAATAATTGGCTCTCCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029749.1-3579s1c1
Sequence:CCGGCGGAGGTATGAGACTCTAGAACTCGAGTTCTAGAGTCTCATACCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029749.1-4257s1c1
Sequence:CCGGCCTTATTCCAAACGGATACTTCTCGAGAAGTATCCGTTTGGAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029749.1-2024s1c1
Sequence:CCGGCGTCCTGCTAAATGGTGCTAACTCGAGTTAGCACCATTTAGCAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029749.1-2582s1c1
Sequence:CCGGGAAAGGTGATACAGCTGAGAACTCGAGTTCTCAGCTGTATCACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029749.1-775s1c1
Sequence:CCGGGCTACCTAAGATCCCGAGTTACTCGAGTAACTCGGGATCTTAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029749.1-4159s1c1
Sequence:CCGGGCTTCTTTAGTACATACTGTACTCGAGTACAGTATGTACTAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029749
USP42 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 42
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029749.2-899s1c1
Sequence:CCGGGACATAACGTTGGAGATTAAGCTCGAGCTTAATCTCCAACGTTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029749.2-1163s1c1
Sequence:CCGGCCCAATGGAGAGCCAATTATTCTCGAGAATAATTGGCTCTCCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029749.1-3579s1c1
Sequence:CCGGCGGAGGTATGAGACTCTAGAACTCGAGTTCTAGAGTCTCATACCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029749.1-4257s1c1
Sequence:CCGGCCTTATTCCAAACGGATACTTCTCGAGAAGTATCCGTTTGGAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029749.1-2024s1c1
Sequence:CCGGCGTCCTGCTAAATGGTGCTAACTCGAGTTAGCACCATTTAGCAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029749.1-2582s1c1
Sequence:CCGGGAAAGGTGATACAGCTGAGAACTCGAGTTCTCAGCTGTATCACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029749.1-775s1c1
Sequence:CCGGGCTACCTAAGATCCCGAGTTACTCGAGTAACTCGGGATCTTAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029749.1-4159s1c1
Sequence:CCGGGCTTCTTTAGTACATACTGTACTCGAGTACAGTATGTACTAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks