EMAIL THIS PAGE TO A FRIEND

USP43

ubiquitin specific peptidase 43

UniProtKB ID: Q70EL4, A6NDT9, B7ZLT9, B7ZVX5, Q8N2C5, Q96DQ6
Gene ID:
Mouse(216835) ubiquitin specific peptidase 43
Rat(100147704) ubiquitin specific peptidase 43
cow(506996) ubiquitin specific peptidase 43
sheep(101102405) ubiquitin specific peptidase 43
domestic guinea pig(100735629) ubiquitin specific peptidase 43
naked mole-rat(101723762) ubiquitin specific peptidase 43
chicken(101667320) ubiquitin specific peptidase 43
chicken(101751148) ubiquitin specific peptidase 43
dog(489498) ubiquitin specific peptidase 43
domestic cat(101083122) ubiquitin specific peptidase 43
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173754 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173754 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173754 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153210 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU067361 MISSION® esiRNA esiRNA targeting mouse Usp43 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153210 Rosetta Predictions human pricing
XM_371015 Rosetta Predictions human pricing
XM_934209 Rosetta Predictions human pricing
XM_934216 Rosetta Predictions human pricing
XM_934221 Rosetta Predictions human pricing
NM_001126303 Rosetta Predictions rat pricing
NM_173754 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367061 predicted 962
2 SASI_Hs02_00367062 predicted 2361
3 SASI_Hs02_00367063 predicted 718
4 SASI_Hs02_00367064 predicted 1676
5 SASI_Hs02_00367065 predicted 654
6 SASI_Hs02_00367066 predicted 723
7 SASI_Hs02_00367067 predicted 1921
8 SASI_Hs02_00367068 predicted 1728
9 SASI_Hs02_00367069 predicted 2781
10 SASI_Hs02_00367070 predicted 1810
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281288 predicted 1019
2 SASI_Hs01_00281289 predicted 532
3 SASI_Hs01_00281290 predicted 2424
4 SASI_Hs01_00281291 predicted 767
5 SASI_Hs01_00281292 predicted 1740
6 SASI_Hs01_00281293 predicted 714
7 SASI_Hs01_00281294 predicted 788
8 SASI_Hs01_00281295 predicted 1979
9 SASI_Hs01_00281296 predicted 1777
10 SASI_Hs01_00281297 predicted 2835
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250664 predicted 2241
2 SASI_Hs01_00250665 predicted 489
3 SASI_Hs01_00250666 predicted 1887
4 SASI_Hs01_00250667 predicted 1628
5 SASI_Hs01_00250668 predicted 1206
6 SASI_Hs01_00250669 predicted 1458
7 SASI_Hs01_00250670 predicted 1255
8 SASI_Hs01_00250671 predicted 2302
9 SASI_Hs01_00250672 predicted 254
10 SASI_Hs01_00250673 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293719 predicted 203
2 SASI_Hs01_00293720 predicted 593
3 SASI_Hs01_00293721 predicted 634
4 SASI_Hs01_00293722 predicted 518
5 SASI_Hs01_00293723 predicted 1814
6 SASI_Hs01_00293724 predicted 1558
7 SASI_Hs01_00293725 predicted 936
8 SASI_Hs01_00293726 predicted 254
9 SASI_Hs01_00293727 predicted 707
10 SASI_Hs01_00293728 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274671 predicted 2342
2 SASI_Hs01_00274672 predicted 592
3 SASI_Hs01_00274673 predicted 1998
4 SASI_Hs01_00274674 predicted 1729
5 SASI_Hs01_00274675 predicted 1307
6 SASI_Hs01_00274676 predicted 1554
7 SASI_Hs01_00274677 predicted 1357
8 SASI_Hs01_00274678 predicted 2409
9 SASI_Hs01_00274679 predicted 1439
10 SASI_Hs01_00274680 predicted 2356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253403 predicted 268
2 SASI_Rn02_00253404 predicted 505
3 SASI_Rn02_00253405 predicted 2577
4 SASI_Rn02_00253406 predicted 2748
5 SASI_Rn02_00253407 predicted 948
6 SASI_Rn02_00253408 predicted 321
7 SASI_Rn02_00253409 predicted 518
8 SASI_Rn02_00253410 predicted 617
9 SASI_Rn02_00253411 predicted 284
10 SASI_Rn02_00253412 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199527 predicted 2434
2 SASI_Mm01_00199528 predicted 3051
3 SASI_Mm01_00199529 predicted 836
4 SASI_Mm01_00199530 predicted 600
5 SASI_Mm01_00199531 predicted 3368
6 SASI_Mm01_00199532 predicted 2623
7 SASI_Mm01_00199534 predicted 820
8 SASI_Mm01_00199535 predicted 605
9 SASI_Mm01_00199536 predicted 1138
10 SASI_Mm02_00345399 predicted 404
11 SASI_Mm01_00199533 predicted 433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173754
USP43 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 43
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-1196s1c1
Sequence:CCGGCGTTCTTGATTCGGGAAGATACTCGAGTATCTTCCCGAATCAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-436s1c1
Sequence:CCGGGCAGAGTTCAAGAATGCTGTTCTCGAGAACAGCATTCTTGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-985s1c1
Sequence:CCGGGCAGAGGGTGACAATGTGTATCTCGAGATACACATTGTCACCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-2901s1c1
Sequence:CCGGCTTACCCAAGATGAAGTCTAACTCGAGTTAGACTTCATCTTGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-1888s1c1
Sequence:CCGGGACTTCCTCTACGACTTGTATCTCGAGATACAAGTCGTAGAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173754
USP43 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 43
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-1196s1c1
Sequence:CCGGCGTTCTTGATTCGGGAAGATACTCGAGTATCTTCCCGAATCAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-436s1c1
Sequence:CCGGGCAGAGTTCAAGAATGCTGTTCTCGAGAACAGCATTCTTGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-985s1c1
Sequence:CCGGGCAGAGGGTGACAATGTGTATCTCGAGATACACATTGTCACCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-2901s1c1
Sequence:CCGGCTTACCCAAGATGAAGTCTAACTCGAGTTAGACTTCATCTTGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-1888s1c1
Sequence:CCGGGACTTCCTCTACGACTTGTATCTCGAGATACAAGTCGTAGAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173754
USP43 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 43
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-1196s1c1
Sequence:CCGGCGTTCTTGATTCGGGAAGATACTCGAGTATCTTCCCGAATCAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-436s1c1
Sequence:CCGGGCAGAGTTCAAGAATGCTGTTCTCGAGAACAGCATTCTTGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-985s1c1
Sequence:CCGGGCAGAGGGTGACAATGTGTATCTCGAGATACACATTGTCACCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-2901s1c1
Sequence:CCGGCTTACCCAAGATGAAGTCTAACTCGAGTTAGACTTCATCTTGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173754.2-1888s1c1
Sequence:CCGGGACTTCCTCTACGACTTGTATCTCGAGATACAAGTCGTAGAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153210
USP43 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 43
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153210.3-1037s21c1
Sequence:CCGGCCATCGCAGAGGGAGATAATGCTCGAGCATTATCTCCCTCTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153210.3-719s21c1
Sequence:CCGGGCCACTTTCAAGCACAATATACTCGAGTATATTGTGCTTGAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153210.3-1393s21c1
Sequence:CCGGTCTGTGGCCTGCAGCTATTTGCTCGAGCAAATAGCTGCAGGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153210.3-3535s21c1
Sequence:CCGGCAACACCCAAGGTCCATATAACTCGAGTTATATGGACCTTGGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153210.3-994s21c1
Sequence:CCGGAGTGGATTCCAGCGGTCTTTCCTCGAGGAAAGACCGCTGGAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153210
USP43 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 43
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153210.3-1037s21c1
Sequence:CCGGCCATCGCAGAGGGAGATAATGCTCGAGCATTATCTCCCTCTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153210.3-719s21c1
Sequence:CCGGGCCACTTTCAAGCACAATATACTCGAGTATATTGTGCTTGAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153210.3-1393s21c1
Sequence:CCGGTCTGTGGCCTGCAGCTATTTGCTCGAGCAAATAGCTGCAGGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153210.3-3535s21c1
Sequence:CCGGCAACACCCAAGGTCCATATAACTCGAGTTATATGGACCTTGGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153210.3-994s21c1
Sequence:CCGGAGTGGATTCCAGCGGTCTTTCCTCGAGGAAAGACCGCTGGAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153210
USP43 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 43
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153210.3-1037s21c1
Sequence:CCGGCCATCGCAGAGGGAGATAATGCTCGAGCATTATCTCCCTCTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153210.3-719s21c1
Sequence:CCGGGCCACTTTCAAGCACAATATACTCGAGTATATTGTGCTTGAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153210.3-1393s21c1
Sequence:CCGGTCTGTGGCCTGCAGCTATTTGCTCGAGCAAATAGCTGCAGGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153210.3-3535s21c1
Sequence:CCGGCAACACCCAAGGTCCATATAACTCGAGTTATATGGACCTTGGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153210.3-994s21c1
Sequence:CCGGAGTGGATTCCAGCGGTCTTTCCTCGAGGAAAGACCGCTGGAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks