EMAIL THIS PAGE TO A FRIEND

USP44

ubiquitin specific peptidase 44

UniProtKB ID: Q9H0E7, B2RDW3
Gene ID:
Human(84101) Summary: Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP44 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]
Mouse(327799) ubiquitin specific peptidase 44
Rat(314746) ubiquitin specific peptidase 44
Zebrafish(393227) ubiquitin specific peptidase 44
chicken(417913) ubiquitin specific peptidase 44
dog(475430) ubiquitin specific peptidase 44
domestic cat(101082926) ubiquitin specific peptidase 44
Horse(100065395) ubiquitin specific peptidase 44
naked mole-rat(101704656) ubiquitin specific peptidase 44
Domestic Rabbit(100347648) ubiquitin specific peptidase 44
domestic guinea pig(100724229) ubiquitin specific peptidase 44
cow(517022) ubiquitin specific peptidase 44
sheep(101117743) ubiquitin specific peptidase 44
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032147 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005411 MISSION® esiRNA esiRNA targeting human USP44 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042403 Rosetta Predictions human pricing
NM_032147 Rosetta Predictions human pricing
NM_001108083 Rosetta Predictions rat pricing
NM_183199 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309548 predicted 596
2 SASI_Hs02_00309549 predicted 1585
3 SASI_Hs02_00309550 predicted 1567
4 SASI_Hs02_00309551 predicted 1073
5 SASI_Hs02_00309552 predicted 767
6 SASI_Hs02_00309553 predicted 1605
7 SASI_Hs02_00309554 predicted 1553
8 SASI_Hs02_00309555 predicted 1304
9 SASI_Hs02_00309556 predicted 1086
10 SASI_Hs02_00309557 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359381 predicted 1732
2 SASI_Hs01_00075742 predicted 1705
3 SASI_Hs01_00075743 predicted 1217
4 SASI_Hs01_00075744 predicted 1746
5 SASI_Hs02_00359382 predicted 1693
6 SASI_Hs01_00075747 predicted 1450
7 SASI_Hs01_00075749 predicted 1234
8 SASI_Hs01_00075750 predicted 1257
9 SASI_Hs01_00075751 predicted 2170
10 SASI_Hs02_00359383 predicted 1522
11 SASI_Hs01_00075745 predicted 1400
12 SASI_Hs01_00075746 predicted 2298
13 SASI_Hs01_00075748 predicted 2003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235184 predicted 1818
2 SASI_Rn02_00235185 predicted 878
3 SASI_Rn02_00235186 predicted 1235
4 SASI_Rn02_00235187 predicted 1724
5 SASI_Rn02_00235188 predicted 537
6 SASI_Rn02_00235189 predicted 773
7 SASI_Rn02_00235190 predicted 579
8 SASI_Rn02_00235191 predicted 1678
9 SASI_Rn02_00235192 predicted 1769
10 SASI_Rn02_00235193 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081280 predicted 1181
2 SASI_Mm01_00081281 predicted 513
3 SASI_Mm01_00081282 predicted 1803
4 SASI_Mm01_00081283 predicted 607
5 SASI_Mm01_00081284 predicted 472
6 SASI_Mm01_00081285 predicted 1474
7 SASI_Mm01_00081286 predicted 1574
8 SASI_Mm01_00081287 predicted 520
9 SASI_Mm01_00081289 predicted 1248
10 SASI_Mm02_00350310 predicted 1648
11 SASI_Mm01_00081288 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032147
VALIDATED
USP44 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 44
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032147.2-872s21c1
Sequence:CCGGGAATTGGAGTATCAAGTTAAACTCGAGTTTAACTTGATACTCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032147.2-941s21c1
Sequence:CCGGCTCGCTCAGTCGACCATAATACTCGAGTATTATGGTCGACTGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032147.2-2195s21c1
Sequence:CCGGTACACTGCCTACTGCTATAATCTCGAGATTATAGCAGTAGGCAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032147.2-573s21c1
Sequence:GTACCGGAGTTACTACGACGTACATTAACTCGAGTTAATGTACGTCGTAGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032147.2-2875s21c1
Sequence:GTACCGGATGTCAAGGTATCACCTAAATCTCGAGATTTAGGTGATACCTTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_032147.1-2653s1c1
Sequence:CCGGCGGATGATGAACTTGTGCAATCTCGAGATTGCACAAGTTCATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032147.1-2364s1c1
Sequence:CCGGCCTCGTCTAATGAAATCCTTACTCGAGTAAGGATTTCATTAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_032147.1-703s1c1
Sequence:CCGGGCACAGGAGAAGGATACTAATCTCGAGATTAGTATCCTTCTCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032147.1-449s1c1
Sequence:CCGGCCTGTTGCATTGGAGGTGAATCTCGAGATTCACCTCCAATGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032147.1-830s1c1
Sequence:CCGGCGGCAGGAATTGGAGTATCAACTCGAGTTGATACTCCAATTCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032147
VALIDATED
USP44 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 44
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032147.2-872s21c1
Sequence:CCGGGAATTGGAGTATCAAGTTAAACTCGAGTTTAACTTGATACTCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032147.2-941s21c1
Sequence:CCGGCTCGCTCAGTCGACCATAATACTCGAGTATTATGGTCGACTGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032147.2-2195s21c1
Sequence:CCGGTACACTGCCTACTGCTATAATCTCGAGATTATAGCAGTAGGCAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032147.2-573s21c1
Sequence:GTACCGGAGTTACTACGACGTACATTAACTCGAGTTAATGTACGTCGTAGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032147.2-2875s21c1
Sequence:GTACCGGATGTCAAGGTATCACCTAAATCTCGAGATTTAGGTGATACCTTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_032147.1-2653s1c1
Sequence:CCGGCGGATGATGAACTTGTGCAATCTCGAGATTGCACAAGTTCATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032147.1-2364s1c1
Sequence:CCGGCCTCGTCTAATGAAATCCTTACTCGAGTAAGGATTTCATTAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_032147.1-703s1c1
Sequence:CCGGGCACAGGAGAAGGATACTAATCTCGAGATTAGTATCCTTCTCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032147.1-449s1c1
Sequence:CCGGCCTGTTGCATTGGAGGTGAATCTCGAGATTCACCTCCAATGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032147.1-830s1c1
Sequence:CCGGCGGCAGGAATTGGAGTATCAACTCGAGTTGATACTCCAATTCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032147
VALIDATED
USP44 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 44
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032147.2-872s21c1
Sequence:CCGGGAATTGGAGTATCAAGTTAAACTCGAGTTTAACTTGATACTCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032147.2-941s21c1
Sequence:CCGGCTCGCTCAGTCGACCATAATACTCGAGTATTATGGTCGACTGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032147.2-2195s21c1
Sequence:CCGGTACACTGCCTACTGCTATAATCTCGAGATTATAGCAGTAGGCAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032147.2-573s21c1
Sequence:GTACCGGAGTTACTACGACGTACATTAACTCGAGTTAATGTACGTCGTAGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032147.2-2875s21c1
Sequence:GTACCGGATGTCAAGGTATCACCTAAATCTCGAGATTTAGGTGATACCTTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_032147.1-2653s1c1
Sequence:CCGGCGGATGATGAACTTGTGCAATCTCGAGATTGCACAAGTTCATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032147.1-2364s1c1
Sequence:CCGGCCTCGTCTAATGAAATCCTTACTCGAGTAAGGATTTCATTAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_032147.1-703s1c1
Sequence:CCGGGCACAGGAGAAGGATACTAATCTCGAGATTAGTATCCTTCTCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032147.1-449s1c1
Sequence:CCGGCCTGTTGCATTGGAGGTGAATCTCGAGATTCACCTCCAATGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032147.1-830s1c1
Sequence:CCGGCGGCAGGAATTGGAGTATCAACTCGAGTTGATACTCCAATTCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183199
USP44 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 44
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-299s1c1
Sequence:CCGGCCCTCAGAAATGGTACTGTATCTCGAGATACAGTACCATTTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-861s1c1
Sequence:CCGGCGGAAGAGTTTACGCTTACAACTCGAGTTGTAAGCGTAAACTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-1365s1c1
Sequence:CCGGGCTCAGGAATTTCTTTGTGAACTCGAGTTCACAAAGAAATTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-1607s1c1
Sequence:CCGGGTGGGAAAGTTGGTGGCATTTCTCGAGAAATGCCACCAACTTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-1671s1c1
Sequence:CCGGCGGATCTCTGAATCATTGGAACTCGAGTTCCAATGATTCAGAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183199
USP44 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 44
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-299s1c1
Sequence:CCGGCCCTCAGAAATGGTACTGTATCTCGAGATACAGTACCATTTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-861s1c1
Sequence:CCGGCGGAAGAGTTTACGCTTACAACTCGAGTTGTAAGCGTAAACTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-1365s1c1
Sequence:CCGGGCTCAGGAATTTCTTTGTGAACTCGAGTTCACAAAGAAATTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-1607s1c1
Sequence:CCGGGTGGGAAAGTTGGTGGCATTTCTCGAGAAATGCCACCAACTTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-1671s1c1
Sequence:CCGGCGGATCTCTGAATCATTGGAACTCGAGTTCCAATGATTCAGAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183199
USP44 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 44
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-299s1c1
Sequence:CCGGCCCTCAGAAATGGTACTGTATCTCGAGATACAGTACCATTTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-861s1c1
Sequence:CCGGCGGAAGAGTTTACGCTTACAACTCGAGTTGTAAGCGTAAACTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-1365s1c1
Sequence:CCGGGCTCAGGAATTTCTTTGTGAACTCGAGTTCACAAAGAAATTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-1607s1c1
Sequence:CCGGGTGGGAAAGTTGGTGGCATTTCTCGAGAAATGCCACCAACTTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183199.1-1671s1c1
Sequence:CCGGCGGATCTCTGAATCATTGGAACTCGAGTTCCAATGATTCAGAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks