EMAIL THIS PAGE TO A FRIEND

USP45

ubiquitin specific peptidase 45

UniProtKB ID: Q70EL2, B2RXG0, Q5T062, Q86T44, Q86TC0, Q9BRU1
Gene ID:
Mouse(77593) ubiquitin specific petidase 45
Rat(313098) ubiquitin specific peptidase 45
cow(540972) ubiquitin specific peptidase 45
sheep(101103161) ubiquitin specific peptidase 45
domestic guinea pig(100713634) ubiquitin specific peptidase 45
Domestic Rabbit(100348405) ubiquitin specific peptidase 45
naked mole-rat(101713420) ubiquitin specific peptidase 45
Zebrafish(564004) ubiquitin specific peptidase 45
chicken(421793) ubiquitin specific peptidase 45
dog(481933) ubiquitin specific peptidase 45
Horse(100071616) ubiquitin specific peptidase 45
domestic cat(101085377) ubiquitin specific peptidase 45
199 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080481 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080481 Rosetta Predictions human pricing
XM_371838 Rosetta Predictions human pricing
XM_931067 Rosetta Predictions human pricing
XM_931071 Rosetta Predictions human pricing
XM_931075 Rosetta Predictions human pricing
XM_931078 Rosetta Predictions human pricing
XM_931082 Rosetta Predictions human pricing
XM_931086 Rosetta Predictions human pricing
XM_931094 Rosetta Predictions human pricing
XM_931109 Rosetta Predictions human pricing
XM_931115 Rosetta Predictions human pricing
XM_931124 Rosetta Predictions human pricing
NM_001107918 Rosetta Predictions rat pricing
NM_152825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315256 predicted 2404
2 SASI_Hs02_00315257 predicted 2767
3 SASI_Hs02_00315258 predicted 2439
4 SASI_Hs02_00315259 predicted 896
5 SASI_Hs02_00315260 predicted 1837
6 SASI_Hs02_00315261 predicted 2931
7 SASI_Hs02_00315262 predicted 1144
8 SASI_Hs02_00315263 predicted 739
9 SASI_Hs02_00315264 predicted 1458
10 SASI_Hs02_00315265 predicted 2532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281557 predicted 1041
2 SASI_Hs01_00281558 predicted 930
3 SASI_Hs01_00281559 predicted 973
4 SASI_Hs01_00281560 predicted 935
5 SASI_Hs01_00281561 predicted 1149
6 SASI_Hs01_00281562 predicted 1149
7 SASI_Hs01_00281563 predicted 928
8 SASI_Hs01_00281564 predicted 1142
9 SASI_Hs01_00281565 predicted 1017
10 SASI_Hs01_00281566 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261978 predicted 205
2 SASI_Hs01_00261979 predicted 239
3 SASI_Hs01_00261980 predicted 255
4 SASI_Hs01_00261981 predicted 301
5 SASI_Hs01_00261982 predicted 207
6 SASI_Hs01_00261983 predicted 335
7 SASI_Hs01_00261984 predicted 212
8 SASI_Hs01_00261985 predicted 239
9 SASI_Hs01_00261986 predicted 257
10 SASI_Hs01_00261987 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292232 predicted 563
2 SASI_Hs01_00292233 predicted 452
3 SASI_Hs01_00292234 predicted 497
4 SASI_Hs01_00292235 predicted 448
5 SASI_Hs01_00292236 predicted 670
6 SASI_Hs01_00292237 predicted 678
7 SASI_Hs01_00292238 predicted 449
8 SASI_Hs01_00292239 predicted 671
9 SASI_Hs01_00292240 predicted 547
10 SASI_Hs01_00292241 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264674 predicted 1041
2 SASI_Hs01_00264675 predicted 931
3 SASI_Hs01_00264676 predicted 980
4 SASI_Hs01_00264677 predicted 936
5 SASI_Hs01_00264678 predicted 1143
6 SASI_Hs01_00264679 predicted 1153
7 SASI_Hs01_00264680 predicted 929
8 SASI_Hs01_00264681 predicted 1143
9 SASI_Hs01_00264682 predicted 1025
10 SASI_Hs01_00264683 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291026 predicted 1044
2 SASI_Hs01_00291027 predicted 933
3 SASI_Hs01_00291028 predicted 978
4 SASI_Hs01_00291029 predicted 926
5 SASI_Hs01_00291030 predicted 1139
6 SASI_Hs01_00291031 predicted 1154
7 SASI_Hs01_00291032 predicted 927
8 SASI_Hs01_00291033 predicted 1144
9 SASI_Hs01_00291034 predicted 1023
10 SASI_Hs01_00291035 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291265 predicted 1041
2 SASI_Hs01_00291266 predicted 939
3 SASI_Hs01_00291267 predicted 981
4 SASI_Hs01_00291268 predicted 927
5 SASI_Hs01_00291269 predicted 1140
6 SASI_Hs01_00291270 predicted 1155
7 SASI_Hs01_00291271 predicted 927
8 SASI_Hs01_00291272 predicted 1146
9 SASI_Hs01_00291273 predicted 1019
10 SASI_Hs01_00291274 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291234 predicted 1048
2 SASI_Hs01_00291235 predicted 936
3 SASI_Hs01_00291236 predicted 982
4 SASI_Hs01_00291237 predicted 928
5 SASI_Hs01_00291238 predicted 1139
6 SASI_Hs01_00291239 predicted 1152
7 SASI_Hs01_00291240 predicted 927
8 SASI_Hs01_00291241 predicted 1150
9 SASI_Hs01_00291242 predicted 1019
10 SASI_Hs01_00291243 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254853 predicted 1044
2 SASI_Hs01_00254854 predicted 930
3 SASI_Hs01_00254855 predicted 976
4 SASI_Hs01_00254856 predicted 926
5 SASI_Hs01_00254857 predicted 1142
6 SASI_Hs01_00254858 predicted 1152
7 SASI_Hs01_00254859 predicted 936
8 SASI_Hs01_00254860 predicted 1142
9 SASI_Hs01_00254861 predicted 1024
10 SASI_Hs01_00254862 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282699 predicted 599
2 SASI_Hs01_00282700 predicted 290
3 SASI_Hs01_00282701 predicted 609
4 SASI_Hs01_00282702 predicted 214
5 SASI_Hs01_00282703 predicted 370
6 SASI_Hs01_00282704 predicted 446
7 SASI_Hs01_00282705 predicted 507
8 SASI_Hs01_00282706 predicted 380
9 SASI_Hs01_00282707 predicted 493
10 SASI_Hs01_00282708 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253499 predicted 1464
2 SASI_Hs01_00253500 predicted 1825
3 SASI_Hs01_00253501 predicted 1501
4 SASI_Hs01_00253502 predicted 1574
5 SASI_Hs01_00253503 predicted 902
6 SASI_Hs01_00253504 predicted 1988
7 SASI_Hs01_00253505 predicted 2047
8 SASI_Hs01_00253506 predicted 1585
9 SASI_Hs01_00253507 predicted 556
10 SASI_Hs01_00253508 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265784 predicted 616
2 SASI_Hs01_00265785 predicted 502
3 SASI_Hs01_00265786 predicted 548
4 SASI_Hs01_00265787 predicted 505
5 SASI_Hs01_00265788 predicted 717
6 SASI_Hs01_00265789 predicted 719
7 SASI_Hs01_00265790 predicted 506
8 SASI_Hs01_00265791 predicted 720
9 SASI_Hs01_00265792 predicted 596
10 SASI_Hs01_00265793 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233565 predicted 1254
2 SASI_Rn02_00233566 predicted 639
3 SASI_Rn02_00233567 predicted 1177
4 SASI_Rn02_00233568 predicted 1360
5 SASI_Rn02_00233569 predicted 434
6 SASI_Rn02_00233570 predicted 1171
7 SASI_Rn02_00233571 predicted 1586
8 SASI_Rn02_00233572 predicted 1501
9 SASI_Rn02_00233573 predicted 1439
10 SASI_Rn02_00233574 predicted 1591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035466 predicted 1372
2 SASI_Mm01_00035467 predicted 1879
3 SASI_Mm01_00035468 predicted 292
4 SASI_Mm01_00035469 predicted 2241
5 SASI_Mm01_00035470 predicted 989
6 SASI_Mm01_00035471 predicted 411
7 SASI_Mm01_00035472 predicted 629
8 SASI_Mm01_00035473 predicted 2154
9 SASI_Mm01_00035474 predicted 433
10 SASI_Mm01_00035475 predicted 423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152825
VALIDATED
USP45 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 45
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_152825.1-2349s1c1
Sequence:CCGGGCCGGTTTGAAAGAACCTGATCTCGAGATCAGGTTCTTTCAAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_152825.1-397s1c1
Sequence:CCGGGCCTGAGTACATGGGTCATATCTCGAGATATGACCCATGTACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152825.1-1099s1c1
Sequence:CCGGGCATCTTTATTGGCGAATTAACTCGAGTTAATTCGCCAATAAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_152825.1-1776s1c1
Sequence:CCGGCCACTAAATGTCCCAAATAATCTCGAGATTATTTGGGACATTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_152825.1-2116s1c1
Sequence:CCGGGCTTGAGTCTTCGTAAAGTAACTCGAGTTACTTTACGAAGACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152825.2-902s21c1
Sequence:CCGGCAGAAGGCTCCTCGGTTTAAACTCGAGTTTAAACCGAGGAGCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152825.2-2591s21c1
Sequence:CCGGTGCATCCTTCCAGCGTTATTTCTCGAGAAATAACGCTGGAAGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152825.2-1115s21c1
Sequence:CCGGCGCATCTTTATTGGCGAATTACTCGAGTAATTCGCCAATAAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152825.2-2133s21c1
Sequence:CCGGGCTTGAGTCTTCGTAAAGTAACTCGAGTTACTTTACGAAGACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_152825.2-2241s21c1
Sequence:CCGGTCTACGGTCTCTACGGTATAGCTCGAGCTATACCGTAGAGACCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152825
VALIDATED
USP45 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 45
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_152825.1-2349s1c1
Sequence:CCGGGCCGGTTTGAAAGAACCTGATCTCGAGATCAGGTTCTTTCAAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_152825.1-397s1c1
Sequence:CCGGGCCTGAGTACATGGGTCATATCTCGAGATATGACCCATGTACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152825.1-1099s1c1
Sequence:CCGGGCATCTTTATTGGCGAATTAACTCGAGTTAATTCGCCAATAAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_152825.1-1776s1c1
Sequence:CCGGCCACTAAATGTCCCAAATAATCTCGAGATTATTTGGGACATTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_152825.1-2116s1c1
Sequence:CCGGGCTTGAGTCTTCGTAAAGTAACTCGAGTTACTTTACGAAGACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152825.2-902s21c1
Sequence:CCGGCAGAAGGCTCCTCGGTTTAAACTCGAGTTTAAACCGAGGAGCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152825.2-2591s21c1
Sequence:CCGGTGCATCCTTCCAGCGTTATTTCTCGAGAAATAACGCTGGAAGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152825.2-1115s21c1
Sequence:CCGGCGCATCTTTATTGGCGAATTACTCGAGTAATTCGCCAATAAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152825.2-2133s21c1
Sequence:CCGGGCTTGAGTCTTCGTAAAGTAACTCGAGTTACTTTACGAAGACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_152825.2-2241s21c1
Sequence:CCGGTCTACGGTCTCTACGGTATAGCTCGAGCTATACCGTAGAGACCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152825
VALIDATED
USP45 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 45
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_152825.1-2349s1c1
Sequence:CCGGGCCGGTTTGAAAGAACCTGATCTCGAGATCAGGTTCTTTCAAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_152825.1-397s1c1
Sequence:CCGGGCCTGAGTACATGGGTCATATCTCGAGATATGACCCATGTACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152825.1-1099s1c1
Sequence:CCGGGCATCTTTATTGGCGAATTAACTCGAGTTAATTCGCCAATAAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_152825.1-1776s1c1
Sequence:CCGGCCACTAAATGTCCCAAATAATCTCGAGATTATTTGGGACATTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_152825.1-2116s1c1
Sequence:CCGGGCTTGAGTCTTCGTAAAGTAACTCGAGTTACTTTACGAAGACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152825.2-902s21c1
Sequence:CCGGCAGAAGGCTCCTCGGTTTAAACTCGAGTTTAAACCGAGGAGCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152825.2-2591s21c1
Sequence:CCGGTGCATCCTTCCAGCGTTATTTCTCGAGAAATAACGCTGGAAGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152825.2-1115s21c1
Sequence:CCGGCGCATCTTTATTGGCGAATTACTCGAGTAATTCGCCAATAAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152825.2-2133s21c1
Sequence:CCGGGCTTGAGTCTTCGTAAAGTAACTCGAGTTACTTTACGAAGACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_152825.2-2241s21c1
Sequence:CCGGTCTACGGTCTCTACGGTATAGCTCGAGCTATACCGTAGAGACCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080481
VALIDATED
USP45 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 45
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080481.1-1576s21c1
Sequence:CCGGACTTCATAGATCGGATCTTTACTCGAGTAAAGATCCGATCTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080481.1-1373s21c1
Sequence:CCGGTCAGAAGGCACCTCGATTTAACTCGAGTTAAATCGAGGTGCCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080481.1-889s21c1
Sequence:CCGGATCTGAGCACATGGATTATATCTCGAGATATAATCCATGTGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080481.1-3618s21c1
Sequence:CCGGTGTAGTTCCCTGGTCATATTTCTCGAGAAATATGACCAGGGAACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080481.1-2563s21c1
Sequence:CCGGCTGTTCCAGCTGTCCTAATTCCTCGAGGAATTAGGACAGCTGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080481
VALIDATED
USP45 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 45
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080481.1-1576s21c1
Sequence:CCGGACTTCATAGATCGGATCTTTACTCGAGTAAAGATCCGATCTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080481.1-1373s21c1
Sequence:CCGGTCAGAAGGCACCTCGATTTAACTCGAGTTAAATCGAGGTGCCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080481.1-889s21c1
Sequence:CCGGATCTGAGCACATGGATTATATCTCGAGATATAATCCATGTGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080481.1-3618s21c1
Sequence:CCGGTGTAGTTCCCTGGTCATATTTCTCGAGAAATATGACCAGGGAACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080481.1-2563s21c1
Sequence:CCGGCTGTTCCAGCTGTCCTAATTCCTCGAGGAATTAGGACAGCTGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080481
VALIDATED
USP45 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 45
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080481.1-1576s21c1
Sequence:CCGGACTTCATAGATCGGATCTTTACTCGAGTAAAGATCCGATCTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080481.1-1373s21c1
Sequence:CCGGTCAGAAGGCACCTCGATTTAACTCGAGTTAAATCGAGGTGCCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080481.1-889s21c1
Sequence:CCGGATCTGAGCACATGGATTATATCTCGAGATATAATCCATGTGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080481.1-3618s21c1
Sequence:CCGGTGTAGTTCCCTGGTCATATTTCTCGAGAAATATGACCAGGGAACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080481.1-2563s21c1
Sequence:CCGGCTGTTCCAGCTGTCCTAATTCCTCGAGGAATTAGGACAGCTGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks