EMAIL THIS PAGE TO A FRIEND

USP46

ubiquitin specific peptidase 46

Gene ID:
Human(64854) Summary: Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP46 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]
Mouse(69727) ubiquitin specific peptidase 46
Rat(289584) ubiquitin specific peptidase 46
Zebrafish(100148916) ubiquitin specific peptidase 46
Horse(100060432) ubiquitin specific peptidase 46
domestic cat(101087060) ubiquitin specific peptidase 46
dog(475142) ubiquitin specific peptidase 46
chicken(422758) ubiquitin specific peptidase 46
naked mole-rat(101703136) ubiquitin specific peptidase 46
cow(516420) ubiquitin specific peptidase 46
sheep(101114871) ubiquitin specific peptidase 46
194 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022832 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177561 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177561 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177561 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022832 Rosetta Predictions human pricing
XM_001068486 Rosetta Predictions rat pricing
XM_001068586 Rosetta Predictions rat pricing
XM_214034 Rosetta Predictions rat pricing
NM_177561 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080807 predicted 1346
2 SASI_Hs01_00080808 predicted 1333
3 SASI_Hs01_00080810 predicted 998
4 SASI_Hs01_00080811 predicted 785
5 SASI_Hs01_00080812 predicted 1503
6 SASI_Hs01_00080813 predicted 224
7 SASI_Hs01_00080814 predicted 1053
8 SASI_Hs01_00080815 predicted 887
9 SASI_Hs01_00080816 predicted 1492
10 SASI_Hs02_00356146 predicted 1219
11 SASI_Hs01_00080809 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068486 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324665 predicted 240
2 SASI_Rn02_00324666 predicted 675
3 SASI_Rn02_00324667 predicted 1075
4 SASI_Rn02_00324668 predicted 792
5 SASI_Rn02_00324669 predicted 276
6 SASI_Rn02_00324670 predicted 780
7 SASI_Rn02_00324671 predicted 336
8 SASI_Rn02_00324672 predicted 1062
9 SASI_Rn02_00324673 predicted 234
10 SASI_Rn02_00324674 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325060 predicted 234
2 SASI_Rn02_00325061 predicted 674
3 SASI_Rn02_00325062 predicted 1075
4 SASI_Rn02_00325063 predicted 788
5 SASI_Rn02_00325064 predicted 774
6 SASI_Rn02_00325065 predicted 1066
7 SASI_Rn02_00325066 predicted 1220
8 SASI_Rn02_00325067 predicted 234
9 SASI_Rn02_00325068 predicted 334
10 SASI_Rn02_00325069 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375109 predicted 1452
2 SASI_Rn02_00375110 predicted 1709
3 SASI_Rn02_00375111 predicted 1440
4 SASI_Rn02_00375112 predicted 1729
5 SASI_Rn02_00375113 predicted 1720
6 SASI_Rn02_00375114 predicted 1651
7 SASI_Rn02_00375115 predicted 1713
8 SASI_Rn02_00375116 predicted 1689
9 SASI_Rn02_00375117 predicted 1697
10 SASI_Rn02_00375118 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038022 predicted 218
2 SASI_Mm01_00038023 predicted 318
3 SASI_Mm01_00038024 predicted 1249
4 SASI_Mm01_00038025 predicted 659
5 SASI_Mm01_00038026 predicted 761
6 SASI_Mm01_00038027 predicted 880
7 SASI_Mm01_00038028 predicted 1263
8 SASI_Mm01_00038029 predicted 778
9 SASI_Mm01_00038030 predicted 1240
10 SASI_Mm01_00038031 predicted 1042
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022832
VALIDATED
USP46 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 46
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-1116s21c1
Sequence:CCGGCGTGGGCATTATATCACTATTCTCGAGAATAGTGATATAATGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-709s21c1
Sequence:CCGGCGCTTACCAATGAAACTCGATCTCGAGATCGAGTTTCATTGGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-1214s21c1
Sequence:CCGGCTATGGCCTGACGTCAGATATCTCGAGATATCTGACGTCAGGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315061    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-1469s21c1
Sequence:CCGGTTCAGTCTGACATAGAGTTAACTCGAGTTAACTCTATGTCAGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-569s21c1
Sequence:CCGGGCTAAACACTATTGCGGACATCTCGAGATGTCCGCAATAGTGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022832.2-1684s1c1
Sequence:CCGGGACAGAAGAATTGGGTAGATACTCGAGTATCTACCCAATTCTTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022832.2-658s1c1
Sequence:CCGGCGCTTACCAATGAAACTCGATCTCGAGATCGAGTTTCATTGGTAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022832.2-518s1c1
Sequence:CCGGGCTAAACACTATTGCGGACATCTCGAGATGTCCGCAATAGTGTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_022832.2-207s1c1
Sequence:CCGGCCAGAGCAGTTTCCAATCAATCTCGAGATTGATTGGAAACTGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022832
VALIDATED
USP46 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 46
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-1116s21c1
Sequence:CCGGCGTGGGCATTATATCACTATTCTCGAGAATAGTGATATAATGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-709s21c1
Sequence:CCGGCGCTTACCAATGAAACTCGATCTCGAGATCGAGTTTCATTGGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-1214s21c1
Sequence:CCGGCTATGGCCTGACGTCAGATATCTCGAGATATCTGACGTCAGGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315061    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-1469s21c1
Sequence:CCGGTTCAGTCTGACATAGAGTTAACTCGAGTTAACTCTATGTCAGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-569s21c1
Sequence:CCGGGCTAAACACTATTGCGGACATCTCGAGATGTCCGCAATAGTGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022832.2-1684s1c1
Sequence:CCGGGACAGAAGAATTGGGTAGATACTCGAGTATCTACCCAATTCTTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022832.2-658s1c1
Sequence:CCGGCGCTTACCAATGAAACTCGATCTCGAGATCGAGTTTCATTGGTAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022832.2-518s1c1
Sequence:CCGGGCTAAACACTATTGCGGACATCTCGAGATGTCCGCAATAGTGTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_022832.2-207s1c1
Sequence:CCGGCCAGAGCAGTTTCCAATCAATCTCGAGATTGATTGGAAACTGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022832
VALIDATED
USP46 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 46
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-1116s21c1
Sequence:CCGGCGTGGGCATTATATCACTATTCTCGAGAATAGTGATATAATGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-709s21c1
Sequence:CCGGCGCTTACCAATGAAACTCGATCTCGAGATCGAGTTTCATTGGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-1214s21c1
Sequence:CCGGCTATGGCCTGACGTCAGATATCTCGAGATATCTGACGTCAGGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315061    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-1469s21c1
Sequence:CCGGTTCAGTCTGACATAGAGTTAACTCGAGTTAACTCTATGTCAGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022832.3-569s21c1
Sequence:CCGGGCTAAACACTATTGCGGACATCTCGAGATGTCCGCAATAGTGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022832.2-1684s1c1
Sequence:CCGGGACAGAAGAATTGGGTAGATACTCGAGTATCTACCCAATTCTTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022832.2-658s1c1
Sequence:CCGGCGCTTACCAATGAAACTCGATCTCGAGATCGAGTTTCATTGGTAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022832.2-518s1c1
Sequence:CCGGGCTAAACACTATTGCGGACATCTCGAGATGTCCGCAATAGTGTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_022832.2-207s1c1
Sequence:CCGGCCAGAGCAGTTTCCAATCAATCTCGAGATTGATTGGAAACTGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177561
USP46 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 46
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177561.2-3007s1c1
Sequence:CCGGCCCTCCATGAAGCATATTTATCTCGAGATAAATATGCTTCATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177561.2-600s1c1
Sequence:CCGGGCCGAGAACAATAAGCCAGAACTCGAGTTCTGGCTTATTGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177561.2-489s1c1
Sequence:CCGGGCTCACGAGTTCTTAAATTATCTCGAGATAATTTAAGAACTCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177561.2-1064s1c1
Sequence:CCGGGCATTACATCACCATCGTAAACTCGAGTTTACGATGGTGATGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177561.2-201s1c1
Sequence:CCGGCCAGAGCAGTTTCCGATCAATCTCGAGATTGATCGGAAACTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177561
USP46 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 46
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177561.2-3007s1c1
Sequence:CCGGCCCTCCATGAAGCATATTTATCTCGAGATAAATATGCTTCATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177561.2-600s1c1
Sequence:CCGGGCCGAGAACAATAAGCCAGAACTCGAGTTCTGGCTTATTGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177561.2-489s1c1
Sequence:CCGGGCTCACGAGTTCTTAAATTATCTCGAGATAATTTAAGAACTCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177561.2-1064s1c1
Sequence:CCGGGCATTACATCACCATCGTAAACTCGAGTTTACGATGGTGATGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177561.2-201s1c1
Sequence:CCGGCCAGAGCAGTTTCCGATCAATCTCGAGATTGATCGGAAACTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177561
USP46 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 46
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177561.2-3007s1c1
Sequence:CCGGCCCTCCATGAAGCATATTTATCTCGAGATAAATATGCTTCATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177561.2-600s1c1
Sequence:CCGGGCCGAGAACAATAAGCCAGAACTCGAGTTCTGGCTTATTGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177561.2-489s1c1
Sequence:CCGGGCTCACGAGTTCTTAAATTATCTCGAGATAATTTAAGAACTCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177561.2-1064s1c1
Sequence:CCGGGCATTACATCACCATCGTAAACTCGAGTTTACGATGGTGATGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177561.2-201s1c1
Sequence:CCGGCCAGAGCAGTTTCCGATCAATCTCGAGATTGATCGGAAACTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks