EMAIL THIS PAGE TO A FRIEND

USP47

ubiquitin specific peptidase 47

Synonyms: TRFP
Gene ID:
Mouse(74996) ubiquitin specific peptidase 47
Rat(308896) ubiquitin specific peptidase 47
Zebrafish(100101645) ubiquitin specific peptidase 47
chicken(423032) ubiquitin specific peptidase 47
dog(100684506) ubiquitin specific peptidase 47
Horse(100071433) ubiquitin specific peptidase 47
domestic cat(101090643) ubiquitin specific peptidase 47
cow(511121) ubiquitin specific peptidase 47
sheep(101122304) ubiquitin specific peptidase 47
domestic guinea pig(100728785) ubiquitin specific peptidase 47
naked mole-rat(101711550) ubiquitin specific peptidase 47
Domestic Rabbit(100353650) ubiquitin specific peptidase 47
212 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017944 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017944 Rosetta Predictions human pricing
NM_001107542 Rosetta Predictions rat pricing
NM_133758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112225 predicted 2159
2 SASI_Hs01_00112227 predicted 3904
3 SASI_Hs02_00350956 predicted 1771
4 SASI_Hs01_00112228 predicted 4009
5 SASI_Hs01_00112229 predicted 1176
6 SASI_Hs02_00350957 predicted 3741
7 SASI_Hs02_00350958 predicted 1330
8 SASI_Hs02_00350959 predicted 1493
9 SASI_Hs02_00350960 predicted 1554
10 SASI_Hs01_00112231 predicted 3212
11 SASI_Hs01_00112224 predicted 2435
12 SASI_Hs01_00112226 predicted 4003
13 SASI_Hs01_00112230 predicted 3398
14 SASI_Hs01_00112232 predicted 3455
15 SASI_Hs01_00112233 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229855 predicted 4201
2 SASI_Rn02_00229856 predicted 1290
3 SASI_Rn02_00229857 predicted 1803
4 SASI_Rn02_00229858 predicted 3259
5 SASI_Rn02_00229859 predicted 3797
6 SASI_Rn02_00229860 predicted 3705
7 SASI_Rn02_00229861 predicted 1959
8 SASI_Rn02_00229862 predicted 849
9 SASI_Rn02_00229863 predicted 1646
10 SASI_Rn02_00229864 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118192 predicted 954
2 SASI_Mm02_00338753 predicted 888
3 SASI_Mm01_00118194 predicted 3642
4 SASI_Mm01_00118195 predicted 1648
5 SASI_Mm02_00338754 predicted 698
6 SASI_Mm01_00118197 predicted 1702
7 SASI_Mm01_00118198 predicted 3103
8 SASI_Mm01_00118200 predicted 3549
9 SASI_Mm01_00118201 predicted 1763
10 SASI_Mm02_00338755 predicted 1056
11 SASI_Mm01_00118193 predicted 2194
12 SASI_Mm01_00118196 predicted 824
13 SASI_Mm01_00118199 predicted 3393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133758
VALIDATED
USP47 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 47
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133758.2-4427s1c1
Sequence:CCGGGCCACTGTCTTGACTTGGAATCTCGAGATTCCAAGTCAAGACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133758.2-973s1c1
Sequence:CCGGCCGTGTTATGTTTGATGCTTTCTCGAGAAAGCATCAAACATAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133758.2-1384s1c1
Sequence:CCGGGCTGGATATGAGCACATTTATCTCGAGATAAATGTGCTCATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133758.2-375s1c1
Sequence:CCGGCCAACAAAGTAGGCTACATAACTCGAGTTATGTAGCCTACTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133758.2-2597s1c1
Sequence:CCGGGCAAATACAATCCGGTTATTTCTCGAGAAATAACCGGATTGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-1384s21c1
Sequence:CCGGGCTGGATATGAGCACATTTATCTCGAGATAAATGTGCTCATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133758.2-5116s21c1
Sequence:CCGGAGGATGTATTTGCTCGTTAATCTCGAGATTAACGAGCAAATACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-4073s21c1
Sequence:CCGGGATGATGGTGCCGTCATATTTCTCGAGAAATATGACGGCACCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-697s21c1
Sequence:CCGGTGGTTATGTGGGATTAGTAAACTCGAGTTTACTAATCCCACATAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-628s21c1
Sequence:CCGGTGTGGCCTCTACCAATGATTACTCGAGTAATCATTGGTAGAGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-308s21c1
Sequence:CCGGGTGAGTGAACGGATCACATTACTCGAGTAATGTGATCCGTTCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133758
VALIDATED
USP47 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 47
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133758.2-4427s1c1
Sequence:CCGGGCCACTGTCTTGACTTGGAATCTCGAGATTCCAAGTCAAGACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133758.2-973s1c1
Sequence:CCGGCCGTGTTATGTTTGATGCTTTCTCGAGAAAGCATCAAACATAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133758.2-1384s1c1
Sequence:CCGGGCTGGATATGAGCACATTTATCTCGAGATAAATGTGCTCATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133758.2-375s1c1
Sequence:CCGGCCAACAAAGTAGGCTACATAACTCGAGTTATGTAGCCTACTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133758.2-2597s1c1
Sequence:CCGGGCAAATACAATCCGGTTATTTCTCGAGAAATAACCGGATTGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-1384s21c1
Sequence:CCGGGCTGGATATGAGCACATTTATCTCGAGATAAATGTGCTCATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133758.2-5116s21c1
Sequence:CCGGAGGATGTATTTGCTCGTTAATCTCGAGATTAACGAGCAAATACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-4073s21c1
Sequence:CCGGGATGATGGTGCCGTCATATTTCTCGAGAAATATGACGGCACCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-697s21c1
Sequence:CCGGTGGTTATGTGGGATTAGTAAACTCGAGTTTACTAATCCCACATAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-628s21c1
Sequence:CCGGTGTGGCCTCTACCAATGATTACTCGAGTAATCATTGGTAGAGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-308s21c1
Sequence:CCGGGTGAGTGAACGGATCACATTACTCGAGTAATGTGATCCGTTCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133758
VALIDATED
USP47 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 47
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133758.2-4427s1c1
Sequence:CCGGGCCACTGTCTTGACTTGGAATCTCGAGATTCCAAGTCAAGACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133758.2-973s1c1
Sequence:CCGGCCGTGTTATGTTTGATGCTTTCTCGAGAAAGCATCAAACATAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133758.2-1384s1c1
Sequence:CCGGGCTGGATATGAGCACATTTATCTCGAGATAAATGTGCTCATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133758.2-375s1c1
Sequence:CCGGCCAACAAAGTAGGCTACATAACTCGAGTTATGTAGCCTACTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133758.2-2597s1c1
Sequence:CCGGGCAAATACAATCCGGTTATTTCTCGAGAAATAACCGGATTGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-1384s21c1
Sequence:CCGGGCTGGATATGAGCACATTTATCTCGAGATAAATGTGCTCATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133758.2-5116s21c1
Sequence:CCGGAGGATGTATTTGCTCGTTAATCTCGAGATTAACGAGCAAATACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-4073s21c1
Sequence:CCGGGATGATGGTGCCGTCATATTTCTCGAGAAATATGACGGCACCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-697s21c1
Sequence:CCGGTGGTTATGTGGGATTAGTAAACTCGAGTTTACTAATCCCACATAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-628s21c1
Sequence:CCGGTGTGGCCTCTACCAATGATTACTCGAGTAATCATTGGTAGAGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133758.2-308s21c1
Sequence:CCGGGTGAGTGAACGGATCACATTACTCGAGTAATGTGATCCGTTCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017944
VALIDATED
USP47 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 47
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017944.2-4208s1c1
Sequence:CCGGCGGAATCATGTTGTGCACTATCTCGAGATAGTGCACAACATGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017944.2-1713s1c1
Sequence:CCGGGCGCAATACATGCAAGATAAACTCGAGTTTATCTTGCATGTATTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_017944.2-1139s1c1
Sequence:CCGGCCGAGGAACTAGATATGAGTACTCGAGTACTCATATCTAGTTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017944.2-3091s1c1
Sequence:CCGGGCAGCTTTCAAACAACATTTACTCGAGTAAATGTTGTTTGAAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017944.2-401s1c1
Sequence:CCGGCCAGTGATTATGTCAGCCAAACTCGAGTTTGGCTGACATAATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017944.3-4803s21c1
Sequence:CCGGCGGAATCATGTTGTGCACTATCTCGAGATAGTGCACAACATGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017944.3-829s21c1
Sequence:CCGGGTCACTTCTCGACGCTAATTTCTCGAGAAATTAGCGTCGAGAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017944.3-2308s21c1
Sequence:CCGGGCGCAATACATGCAAGATAAACTCGAGTTTATCTTGCATGTATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_017944.3-1991s21c1
Sequence:CCGGAGCGCTGCTGGTGGTCATTATCTCGAGATAATGACCACCAGCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017944.3-3686s21c1
Sequence:CCGGGCAGCTTTCAAACAACATTTACTCGAGTAAATGTTGTTTGAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017944
VALIDATED
USP47 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 47
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017944.2-4208s1c1
Sequence:CCGGCGGAATCATGTTGTGCACTATCTCGAGATAGTGCACAACATGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017944.2-1713s1c1
Sequence:CCGGGCGCAATACATGCAAGATAAACTCGAGTTTATCTTGCATGTATTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_017944.2-1139s1c1
Sequence:CCGGCCGAGGAACTAGATATGAGTACTCGAGTACTCATATCTAGTTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017944.2-3091s1c1
Sequence:CCGGGCAGCTTTCAAACAACATTTACTCGAGTAAATGTTGTTTGAAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017944.2-401s1c1
Sequence:CCGGCCAGTGATTATGTCAGCCAAACTCGAGTTTGGCTGACATAATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017944.3-4803s21c1
Sequence:CCGGCGGAATCATGTTGTGCACTATCTCGAGATAGTGCACAACATGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017944.3-829s21c1
Sequence:CCGGGTCACTTCTCGACGCTAATTTCTCGAGAAATTAGCGTCGAGAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017944.3-2308s21c1
Sequence:CCGGGCGCAATACATGCAAGATAAACTCGAGTTTATCTTGCATGTATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_017944.3-1991s21c1
Sequence:CCGGAGCGCTGCTGGTGGTCATTATCTCGAGATAATGACCACCAGCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017944.3-3686s21c1
Sequence:CCGGGCAGCTTTCAAACAACATTTACTCGAGTAAATGTTGTTTGAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017944
VALIDATED
USP47 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 47
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017944.2-4208s1c1
Sequence:CCGGCGGAATCATGTTGTGCACTATCTCGAGATAGTGCACAACATGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017944.2-1713s1c1
Sequence:CCGGGCGCAATACATGCAAGATAAACTCGAGTTTATCTTGCATGTATTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_017944.2-1139s1c1
Sequence:CCGGCCGAGGAACTAGATATGAGTACTCGAGTACTCATATCTAGTTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017944.2-3091s1c1
Sequence:CCGGGCAGCTTTCAAACAACATTTACTCGAGTAAATGTTGTTTGAAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017944.2-401s1c1
Sequence:CCGGCCAGTGATTATGTCAGCCAAACTCGAGTTTGGCTGACATAATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017944.3-4803s21c1
Sequence:CCGGCGGAATCATGTTGTGCACTATCTCGAGATAGTGCACAACATGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017944.3-829s21c1
Sequence:CCGGGTCACTTCTCGACGCTAATTTCTCGAGAAATTAGCGTCGAGAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017944.3-2308s21c1
Sequence:CCGGGCGCAATACATGCAAGATAAACTCGAGTTTATCTTGCATGTATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_017944.3-1991s21c1
Sequence:CCGGAGCGCTGCTGGTGGTCATTATCTCGAGATAATGACCACCAGCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017944.3-3686s21c1
Sequence:CCGGGCAGCTTTCAAACAACATTTACTCGAGTAAATGTTGTTTGAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks