EMAIL THIS PAGE TO A FRIEND

USP48

ubiquitin specific peptidase 48

Synonyms: RAP1GA1 USP31
Gene ID:
Human(84196) Summary: This gene encodes a protein containing domains that associate it with the peptidase family C19, also known as family 2 of ubiquitin carboxyl-terminal hydrolases. Family members function as deubiquitinating enzymes, recognizing and hydrolyzing the peptide bond at the C-terminal glycine of ubiquitin. Enzymes in peptidase family C19 are involved in the processing of poly-ubiquitin precursors as well as that of ubiquitinated proteins. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(170707) ubiquitin specific peptidase 48
Rat(362636) ubiquitin specific peptidase 48
Domestic Rabbit(100354775) ubiquitin specific peptidase 48
naked mole-rat(101698862) ubiquitin specific peptidase 48
domestic guinea pig(100725391) ubiquitin specific peptidase 48
cow(100141158) ubiquitin specific peptidase 48
sheep(101104128) ubiquitin specific peptidase 48
Zebrafish(100332674) ubiquitin specific peptidase 48
chicken(769457) ubiquitin specific peptidase 48
dog(478198) ubiquitin specific peptidase 48
Horse(100068897) ubiquitin specific peptidase 48
Horse(100058232) ubiquitin specific peptidase 48
domestic cat(101094032) ubiquitin specific peptidase 48
326 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032236 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081621 MISSION® esiRNA esiRNA human USP48 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032730 Rosetta Predictions human pricing
NM_032236 Rosetta Predictions human pricing
NM_198785 Rosetta Predictions rat pricing
NM_130879 Rosetta Predictions mouse pricing
XM_001052065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185218 predicted 795
2 SASI_Hs01_00185219 predicted 583
3 SASI_Hs01_00185220 predicted 1292
4 SASI_Hs01_00185221 predicted 890
5 SASI_Hs02_00307958 predicted 800
6 SASI_Hs01_00185222 predicted 1324
7 SASI_Hs01_00185223 predicted 1415
8 SASI_Hs01_00185225 predicted 408
9 SASI_Hs02_00307959 predicted 1328
10 SASI_Hs01_00185226 predicted 486
11 SASI_Hs01_00185224 predicted 814
12 SASI_Hs01_00185227 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077498 predicted 793
2 SASI_Hs01_00077499 predicted 585
3 SASI_Hs01_00077500 predicted 1293
4 SASI_Hs01_00077501 predicted 888
5 SASI_Hs02_00359546 predicted 802
6 SASI_Hs01_00077502 predicted 1321
7 SASI_Hs01_00077503 predicted 1412
8 SASI_Hs01_00077505 predicted 408
9 SASI_Hs01_00077506 predicted 1333
10 SASI_Hs01_00077507 predicted 488
11 SASI_Hs01_00077504 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103640 predicted 2691
2 SASI_Rn01_00103641 predicted 1109
3 SASI_Rn02_00270058 predicted 1629
4 SASI_Rn01_00103642 predicted 1752
5 SASI_Rn01_00103643 predicted 2396
6 SASI_Rn01_00103644 predicted 1224
7 SASI_Rn01_00103645 predicted 2765
8 SASI_Rn02_00270059 predicted 2546
9 SASI_Rn01_00103646 predicted 956
10 SASI_Rn01_00103647 predicted 1309
11 SASI_Rn01_00103648 predicted 1333
12 SASI_Rn01_00103649 predicted 3149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338305 predicted 451
2 SASI_Mm02_00338306 predicted 2893
3 SASI_Mm02_00338307 predicted 1243
4 SASI_Mm02_00338308 predicted 2832
5 SASI_Mm02_00338309 predicted 2697
6 SASI_Mm02_00338310 predicted 1286
7 SASI_Mm02_00338311 predicted 2405
8 SASI_Mm02_00338312 predicted 1234
9 SASI_Mm02_00338313 predicted 3152
10 SASI_Mm02_00338314 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260398 predicted 1096
2 SASI_Mm01_00260399 predicted 1111
3 SASI_Mm01_00260400 predicted 1067
4 SASI_Mm01_00260401 predicted 1173
5 SASI_Mm01_00260402 predicted 1072
6 SASI_Mm01_00260403 predicted 1173
7 SASI_Mm01_00260404 predicted 1283
8 SASI_Mm01_00260405 predicted 1272
9 SASI_Mm01_00260406 predicted 1115
10 SASI_Mm01_00260407 predicted 1117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032236
VALIDATED
USP48 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 48
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032236.5-3710s21c1
Sequence:CCGGCCAGATGCGTTGGTCCATAAACTCGAGTTTATGGACCAACGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_032236.5-1609s21c1
Sequence:CCGGGCGTAAGCAAAGTGTGGATAACTCGAGTTATCCACACTTTGCTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032236.5-525s21c1
Sequence:CCGGCCACTTGTTATGTCAACACATCTCGAGATGTGTTGACATAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032236.5-405s21c1
Sequence:CCGGTTGGTATTGGTGAGCATATTTCTCGAGAAATATGCTCACCAATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032236.5-841s21c1
Sequence:CCGGGAATCCAGATGTGCGCAATATCTCGAGATATTGCGCACATCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032236.3-3153s1c1
Sequence:CCGGGCATTAAAGCAAAGGTGGATTCTCGAGAATCCACCTTTGCTTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032236.3-2721s1c1
Sequence:CCGGGCCACCATCTATGTCCATAAACTCGAGTTTATGGACATAGATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032236.3-1511s1c1
Sequence:CCGGGCGTAAGCAAAGTGTGGATAACTCGAGTTATCCACACTTTGCTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032236.3-1835s1c1
Sequence:CCGGGCGTCTGAAGAACCAACTAAACTCGAGTTTAGTTGGTTCTTCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_032236.3-427s1c1
Sequence:CCGGCCACTTGTTATGTCAACACATCTCGAGATGTGTTGACATAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032236
VALIDATED
USP48 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 48
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032236.5-3710s21c1
Sequence:CCGGCCAGATGCGTTGGTCCATAAACTCGAGTTTATGGACCAACGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_032236.5-1609s21c1
Sequence:CCGGGCGTAAGCAAAGTGTGGATAACTCGAGTTATCCACACTTTGCTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032236.5-525s21c1
Sequence:CCGGCCACTTGTTATGTCAACACATCTCGAGATGTGTTGACATAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032236.5-405s21c1
Sequence:CCGGTTGGTATTGGTGAGCATATTTCTCGAGAAATATGCTCACCAATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032236.5-841s21c1
Sequence:CCGGGAATCCAGATGTGCGCAATATCTCGAGATATTGCGCACATCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032236.3-3153s1c1
Sequence:CCGGGCATTAAAGCAAAGGTGGATTCTCGAGAATCCACCTTTGCTTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032236.3-2721s1c1
Sequence:CCGGGCCACCATCTATGTCCATAAACTCGAGTTTATGGACATAGATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032236.3-1511s1c1
Sequence:CCGGGCGTAAGCAAAGTGTGGATAACTCGAGTTATCCACACTTTGCTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032236.3-1835s1c1
Sequence:CCGGGCGTCTGAAGAACCAACTAAACTCGAGTTTAGTTGGTTCTTCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_032236.3-427s1c1
Sequence:CCGGCCACTTGTTATGTCAACACATCTCGAGATGTGTTGACATAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032236
VALIDATED
USP48 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 48
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032236.5-3710s21c1
Sequence:CCGGCCAGATGCGTTGGTCCATAAACTCGAGTTTATGGACCAACGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_032236.5-1609s21c1
Sequence:CCGGGCGTAAGCAAAGTGTGGATAACTCGAGTTATCCACACTTTGCTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032236.5-525s21c1
Sequence:CCGGCCACTTGTTATGTCAACACATCTCGAGATGTGTTGACATAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032236.5-405s21c1
Sequence:CCGGTTGGTATTGGTGAGCATATTTCTCGAGAAATATGCTCACCAATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032236.5-841s21c1
Sequence:CCGGGAATCCAGATGTGCGCAATATCTCGAGATATTGCGCACATCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032236.3-3153s1c1
Sequence:CCGGGCATTAAAGCAAAGGTGGATTCTCGAGAATCCACCTTTGCTTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032236.3-2721s1c1
Sequence:CCGGGCCACCATCTATGTCCATAAACTCGAGTTTATGGACATAGATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032236.3-1511s1c1
Sequence:CCGGGCGTAAGCAAAGTGTGGATAACTCGAGTTATCCACACTTTGCTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032236.3-1835s1c1
Sequence:CCGGGCGTCTGAAGAACCAACTAAACTCGAGTTTAGTTGGTTCTTCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_032236.3-427s1c1
Sequence:CCGGCCACTTGTTATGTCAACACATCTCGAGATGTGTTGACATAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks