EMAIL THIS PAGE TO A FRIEND

USP49

ubiquitin specific peptidase 49

UniProtKB ID: Q70CQ1, Q5T3D9, Q5T3E0, Q96CK4
Gene ID:
Mouse(224836) ubiquitin specific peptidase 49
Rat(316211) ubiquitin specific peptidase 49
Zebrafish(559473) ubiquitin specific peptidase 49
chicken(419925) ubiquitin specific peptidase 49
Horse(100066518) ubiquitin specific peptidase 49
domestic cat(101091870) ubiquitin specific peptidase 49
dog(474899) ubiquitin specific peptidase 49
cow(517349) ubiquitin specific peptidase 49
sheep(101109570) ubiquitin specific peptidase 49
domestic guinea pig(100715999) ubiquitin specific peptidase 49
naked mole-rat(101711149) ubiquitin specific peptidase 49
Domestic Rabbit(100328717) ubiquitin specific peptidase 49
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018561 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027951 MISSION® esiRNA esiRNA human USP49 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018561 Rosetta Predictions human pricing
XM_001064731 Rosetta Predictions rat pricing
XM_236919 Rosetta Predictions rat pricing
NM_198421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055585 predicted 381
2 SASI_Hs02_00352112 predicted 283
3 SASI_Hs01_00055589 predicted 1527
4 SASI_Hs01_00055590 predicted 1834
5 SASI_Hs02_00352113 predicted 1824
6 SASI_Hs02_00352114 predicted 1576
7 SASI_Hs02_00352115 predicted 1896
8 SASI_Hs02_00352116 predicted 434
9 SASI_Hs01_00055582 predicted 1688
10 SASI_Hs01_00055583 predicted 1639
11 SASI_Hs01_00055584 predicted 1834
12 SASI_Hs01_00055586 predicted 1536
13 SASI_Hs01_00055587 predicted 1824
14 SASI_Hs01_00055588 predicted 1595
15 SASI_Hs01_00055591 predicted 1640
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311567 predicted 468
2 SASI_Rn02_00311568 predicted 1924
3 SASI_Rn02_00311569 predicted 2039
4 SASI_Rn02_00311570 predicted 1201
5 SASI_Rn02_00311571 predicted 1435
6 SASI_Rn02_00311572 predicted 1720
7 SASI_Rn02_00311573 predicted 1685
8 SASI_Rn02_00311574 predicted 2097
9 SASI_Rn02_00311575 predicted 2032
10 SASI_Rn02_00311576 predicted 2033
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390484 predicted 1415
2 SASI_Rn02_00390485 predicted 1367
3 SASI_Rn02_00390486 predicted 1521
4 SASI_Rn02_00390487 predicted 1620
5 SASI_Rn02_00390488 predicted 2043
6 SASI_Rn02_00390489 predicted 1199
7 SASI_Rn02_00390490 predicted 1722
8 SASI_Rn02_00390491 predicted 1689
9 SASI_Rn02_00390492 predicted 1535
10 SASI_Rn02_00390493 predicted 2094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200670 predicted 472
2 SASI_Mm01_00200671 predicted 1667
3 SASI_Mm01_00200672 predicted 1922
4 SASI_Mm01_00200673 predicted 1674
5 SASI_Mm01_00200674 predicted 2282
6 SASI_Mm01_00200676 predicted 2210
7 SASI_Mm02_00350983 predicted 1931
8 SASI_Mm01_00200677 predicted 1687
9 SASI_Mm01_00200678 predicted 1734
10 SASI_Mm01_00200679 predicted 1132
11 SASI_Mm01_00200675 predicted 2092
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018561
USP49 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 49
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018561.x-2194s1c1
Sequence:CCGGCTAGAGGGAAATTACATACATCTCGAGATGTATGTAATTTCCCTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018561.x-430s1c1
Sequence:CCGGCGGGATCTCTACGTGTTCTGTCTCGAGACAGAACACGTAGAGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018561.x-1901s1c1
Sequence:CCGGGCCGTAATCATCGAGAGAAGACTCGAGTCTTCTCTCGATGATTACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018561.x-1570s1c1
Sequence:CCGGCTCAGTCAGGTCACATGTATACTCGAGTATACATGTGACCTGACTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018561.x-1980s1c1
Sequence:CCGGCATGCTCTCCTCTCTTGACAACTCGAGTTGTCAAGAGAGGAGAGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018561.3-1517s21c1
Sequence:CCGGAGCTCACCAAACAGGTCTTAACTCGAGTTAAGACCTGTTTGGTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018561.3-1159s21c1
Sequence:CCGGACGGAGCTGTCCTTGAGAAATCTCGAGATTTCTCAAGGACAGCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018561
USP49 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 49
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018561.x-2194s1c1
Sequence:CCGGCTAGAGGGAAATTACATACATCTCGAGATGTATGTAATTTCCCTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018561.x-430s1c1
Sequence:CCGGCGGGATCTCTACGTGTTCTGTCTCGAGACAGAACACGTAGAGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018561.x-1901s1c1
Sequence:CCGGGCCGTAATCATCGAGAGAAGACTCGAGTCTTCTCTCGATGATTACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018561.x-1570s1c1
Sequence:CCGGCTCAGTCAGGTCACATGTATACTCGAGTATACATGTGACCTGACTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018561.x-1980s1c1
Sequence:CCGGCATGCTCTCCTCTCTTGACAACTCGAGTTGTCAAGAGAGGAGAGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018561.3-1517s21c1
Sequence:CCGGAGCTCACCAAACAGGTCTTAACTCGAGTTAAGACCTGTTTGGTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018561.3-1159s21c1
Sequence:CCGGACGGAGCTGTCCTTGAGAAATCTCGAGATTTCTCAAGGACAGCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018561
USP49 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 49
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018561.x-2194s1c1
Sequence:CCGGCTAGAGGGAAATTACATACATCTCGAGATGTATGTAATTTCCCTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018561.x-430s1c1
Sequence:CCGGCGGGATCTCTACGTGTTCTGTCTCGAGACAGAACACGTAGAGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018561.x-1901s1c1
Sequence:CCGGGCCGTAATCATCGAGAGAAGACTCGAGTCTTCTCTCGATGATTACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018561.x-1570s1c1
Sequence:CCGGCTCAGTCAGGTCACATGTATACTCGAGTATACATGTGACCTGACTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018561.x-1980s1c1
Sequence:CCGGCATGCTCTCCTCTCTTGACAACTCGAGTTGTCAAGAGAGGAGAGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018561.3-1517s21c1
Sequence:CCGGAGCTCACCAAACAGGTCTTAACTCGAGTTAAGACCTGTTTGGTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018561.3-1159s21c1
Sequence:CCGGACGGAGCTGTCCTTGAGAAATCTCGAGATTTCTCAAGGACAGCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198421
USP49 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 49
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-2359s1c1
Sequence:CCGGCGAACGCAGAACATACACATTCTCGAGAATGTGTATGTTCTGCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-1999s1c1
Sequence:CCGGCCGTAACCATCGTGAGAAGATCTCGAGATCTTCTCACGATGGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-1615s1c1
Sequence:CCGGGCTCACCAAACAGGTCTTAAACTCGAGTTTAAGACCTGTTTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-1141s1c1
Sequence:CCGGCCAGAAGTTCCGGGAATGTTTCTCGAGAAACATTCCCGGAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-1934s1c1
Sequence:CCGGCAGTTAATGATCTACAGACTACTCGAGTAGTCTGTAGATCATTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198421
USP49 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 49
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-2359s1c1
Sequence:CCGGCGAACGCAGAACATACACATTCTCGAGAATGTGTATGTTCTGCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-1999s1c1
Sequence:CCGGCCGTAACCATCGTGAGAAGATCTCGAGATCTTCTCACGATGGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-1615s1c1
Sequence:CCGGGCTCACCAAACAGGTCTTAAACTCGAGTTTAAGACCTGTTTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-1141s1c1
Sequence:CCGGCCAGAAGTTCCGGGAATGTTTCTCGAGAAACATTCCCGGAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-1934s1c1
Sequence:CCGGCAGTTAATGATCTACAGACTACTCGAGTAGTCTGTAGATCATTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198421
USP49 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 49
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-2359s1c1
Sequence:CCGGCGAACGCAGAACATACACATTCTCGAGAATGTGTATGTTCTGCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-1999s1c1
Sequence:CCGGCCGTAACCATCGTGAGAAGATCTCGAGATCTTCTCACGATGGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-1615s1c1
Sequence:CCGGGCTCACCAAACAGGTCTTAAACTCGAGTTTAAGACCTGTTTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-1141s1c1
Sequence:CCGGCCAGAAGTTCCGGGAATGTTTCTCGAGAAACATTCCCGGAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198421.1-1934s1c1
Sequence:CCGGCAGTTAATGATCTACAGACTACTCGAGTAGTCTGTAGATCATTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks