EMAIL THIS PAGE TO A FRIEND

USP4

ubiquitin specific peptidase 4 (proto-oncogene)

Synonyms: UNP Unph
UniProtKB ID: Q13107, A8K6Y0, C9IY91, O43452, O43453, Q08AK8
Gene ID:
Human(7375) Summary: The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(22258) ubiquitin specific peptidase 4 (proto-oncogene)
Rat(290864) ubiquitin specific peptidase 4 (proto-oncogene)
naked mole-rat(101710103) ubiquitin specific peptidase 4 (proto-oncogene)
Domestic Rabbit(100359136) ubiquitin specific peptidase 4 (proto-oncogene)
domestic guinea pig(100728835) ubiquitin specific peptidase 4 (proto-oncogene)
cow(508042) ubiquitin specific peptidase 4 (proto-oncogene)
sheep(101105032) ubiquitin specific peptidase 4 (proto-oncogene)
Zebrafish(449927) ubiquitin specific protease 4 (proto-oncogene)
Horse(100053443) ubiquitin specific peptidase 4 (proto-oncogene)
domestic cat(101083327) ubiquitin specific peptidase 4 (proto-oncogene)
chicken(415937) ubiquitin specific peptidase 4 (proto-oncogene)
dog(476624) ubiquitin specific peptidase 4 (proto-oncogene)
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003363 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003363 Rosetta Predictions human pricing
NM_199443 Rosetta Predictions human pricing
NM_001106093 Rosetta Predictions rat pricing
NM_001135012 Rosetta Predictions rat pricing
NM_011678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113975 predicted 2690
2 SASI_Hs01_00113976 predicted 1366
3 SASI_Hs01_00113977 predicted 1885
4 SASI_Hs01_00113978 predicted 1383
5 SASI_Hs01_00113979 predicted 2318
6 SASI_Hs01_00113980 predicted 2190
7 SASI_Hs01_00113981 predicted 1930
8 SASI_Hs01_00113982 predicted 497
9 SASI_Hs01_00113984 predicted 303
10 SASI_Hs02_00335514 predicted 2640
11 SASI_Hs01_00113983 predicted 2577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028215 predicted 2548
2 SASI_Hs01_00028216 predicted 1217
3 SASI_Hs01_00028217 predicted 1752
4 SASI_Hs01_00028218 predicted 1248
5 SASI_Hs01_00028219 predicted 2171
6 SASI_Hs01_00028220 predicted 2054
7 SASI_Hs01_00028221 predicted 1792
8 SASI_Hs01_00028222 predicted 498
9 SASI_Hs01_00028224 predicted 297
10 SASI_Hs02_00372855 predicted 2491
11 SASI_Hs01_00028223 predicted 2437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215562 predicted 2416
2 SASI_Rn02_00215563 predicted 862
3 SASI_Rn02_00215564 predicted 2347
4 SASI_Rn02_00215565 predicted 1746
5 SASI_Rn02_00215566 predicted 407
6 SASI_Rn02_00215567 predicted 289
7 SASI_Rn02_00215568 predicted 1514
8 SASI_Rn02_00215569 predicted 1105
9 SASI_Rn02_00215570 predicted 2538
10 SASI_Rn02_00215571 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001135012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259440 predicted 2551
2 SASI_Rn02_00259441 predicted 999
3 SASI_Rn02_00259442 predicted 2488
4 SASI_Rn02_00259443 predicted 1896
5 SASI_Rn02_00259444 predicted 409
6 SASI_Rn02_00259445 predicted 296
7 SASI_Rn02_00259446 predicted 1656
8 SASI_Rn02_00259447 predicted 1253
9 SASI_Rn02_00259448 predicted 2683
10 SASI_Rn02_00259449 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188489 predicted 1416
2 SASI_Mm01_00188490 predicted 2527
3 SASI_Mm01_00188492 predicted 2620
4 SASI_Mm01_00188493 predicted 2666
5 SASI_Mm01_00188494 predicted 467
6 SASI_Mm01_00188495 predicted 1721
7 SASI_Mm01_00188496 predicted 2636
8 SASI_Mm01_00188497 predicted 2583
9 SASI_Mm01_00188498 predicted 1312
10 SASI_Mm02_00321219 predicted 2717
11 SASI_Mm01_00188491 predicted 2259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003363
VALIDATED
USP4 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 4 (proto-oncogene)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003363.3-2477s21c1
Sequence:CCGGCCCAACTGTAAGAAGCATCAACTCGAGTTGATGCTTCTTACAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003363.3-1049s21c1
Sequence:CCGGGCACCACTGACTGACTACTTTCTCGAGAAAGTAGTCAGTCAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003363.3-2629s21c1
Sequence:CCGGCATGTCCGAGTTTGTCTGTAACTCGAGTTACAGACAAACTCGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003363.3-374s21c1
Sequence:CCGGGAGGCGTGGAATAAACTACTACTCGAGTAGTAGTTTATTCCACGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003363.3-3146s21c1
Sequence:CCGGTATGTCAAGAGGCTGAATTATCTCGAGATAATTCAGCCTCTTGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-2401s1c1
Sequence:CCGGCCCAACTGTAAGAAGCATCAACTCGAGTTGATGCTTCTTACAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-973s1c1
Sequence:CCGGGCACCACTGACTGACTACTTTCTCGAGAAAGTAGTCAGTCAGTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-1385s1c1
Sequence:CCGGGCCCAGAATGTGCTAAGGTTTCTCGAGAAACCTTAGCACATTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-2553s1c1
Sequence:CCGGCATGTCCGAGTTTGTCTGTAACTCGAGTTACAGACAAACTCGGACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-298s1c1
Sequence:CCGGGAGGCGTGGAATAAACTACTACTCGAGTAGTAGTTTATTCCACGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003363
VALIDATED
USP4 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 4 (proto-oncogene)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003363.3-2477s21c1
Sequence:CCGGCCCAACTGTAAGAAGCATCAACTCGAGTTGATGCTTCTTACAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003363.3-1049s21c1
Sequence:CCGGGCACCACTGACTGACTACTTTCTCGAGAAAGTAGTCAGTCAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003363.3-2629s21c1
Sequence:CCGGCATGTCCGAGTTTGTCTGTAACTCGAGTTACAGACAAACTCGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003363.3-374s21c1
Sequence:CCGGGAGGCGTGGAATAAACTACTACTCGAGTAGTAGTTTATTCCACGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003363.3-3146s21c1
Sequence:CCGGTATGTCAAGAGGCTGAATTATCTCGAGATAATTCAGCCTCTTGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-2401s1c1
Sequence:CCGGCCCAACTGTAAGAAGCATCAACTCGAGTTGATGCTTCTTACAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-973s1c1
Sequence:CCGGGCACCACTGACTGACTACTTTCTCGAGAAAGTAGTCAGTCAGTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-1385s1c1
Sequence:CCGGGCCCAGAATGTGCTAAGGTTTCTCGAGAAACCTTAGCACATTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-2553s1c1
Sequence:CCGGCATGTCCGAGTTTGTCTGTAACTCGAGTTACAGACAAACTCGGACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-298s1c1
Sequence:CCGGGAGGCGTGGAATAAACTACTACTCGAGTAGTAGTTTATTCCACGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003363
VALIDATED
USP4 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 4 (proto-oncogene)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003363.3-2477s21c1
Sequence:CCGGCCCAACTGTAAGAAGCATCAACTCGAGTTGATGCTTCTTACAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003363.3-1049s21c1
Sequence:CCGGGCACCACTGACTGACTACTTTCTCGAGAAAGTAGTCAGTCAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003363.3-2629s21c1
Sequence:CCGGCATGTCCGAGTTTGTCTGTAACTCGAGTTACAGACAAACTCGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003363.3-374s21c1
Sequence:CCGGGAGGCGTGGAATAAACTACTACTCGAGTAGTAGTTTATTCCACGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003363.3-3146s21c1
Sequence:CCGGTATGTCAAGAGGCTGAATTATCTCGAGATAATTCAGCCTCTTGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-2401s1c1
Sequence:CCGGCCCAACTGTAAGAAGCATCAACTCGAGTTGATGCTTCTTACAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-973s1c1
Sequence:CCGGGCACCACTGACTGACTACTTTCTCGAGAAAGTAGTCAGTCAGTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-1385s1c1
Sequence:CCGGGCCCAGAATGTGCTAAGGTTTCTCGAGAAACCTTAGCACATTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-2553s1c1
Sequence:CCGGCATGTCCGAGTTTGTCTGTAACTCGAGTTACAGACAAACTCGGACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003363.x-298s1c1
Sequence:CCGGGAGGCGTGGAATAAACTACTACTCGAGTAGTAGTTTATTCCACGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011678
VALIDATED
USP4 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 4 (proto-oncogene)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-3145s21c1
Sequence:CCGGATGTTAAGAGGCTGGATTATTCTCGAGAATAATCCAGCCTCTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-1317s21c1
Sequence:CCGGCCGCGTAAAGAAGAAGCCTTACTCGAGTAAGGCTTCTTCTTTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-385s21c1
Sequence:CCGGGCCTGGAATAAATTGCTGAATCTCGAGATTCAGCAATTTATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-2667s21c1
Sequence:CCGGGCCTTATGTTTATGACCTAATCTCGAGATTAGGTCATAAACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-931s21c1
Sequence:CCGGGGCTTCTCTGCTTCGTATAATCTCGAGATTATACGAAGCAGAGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011678.1-3480s1c1
Sequence:CCGGCCCGGTTATGAAATGAAGTTACTCGAGTAACTTCATTTCATAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011678.1-1280s1c1
Sequence:CCGGCCGCGTAAAGAAGAAGCCTTACTCGAGTAAGGCTTCTTCTTTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011678.1-348s1c1
Sequence:CCGGGCCTGGAATAAATTGCTGAATCTCGAGATTCAGCAATTTATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011678.1-1910s1c1
Sequence:CCGGCCAGGCTGTTTGTGATCGTATCTCGAGATACGATCACAAACAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011678.1-2630s1c1
Sequence:CCGGGCCTTATGTTTATGACCTAATCTCGAGATTAGGTCATAAACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011678
VALIDATED
USP4 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 4 (proto-oncogene)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-3145s21c1
Sequence:CCGGATGTTAAGAGGCTGGATTATTCTCGAGAATAATCCAGCCTCTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-1317s21c1
Sequence:CCGGCCGCGTAAAGAAGAAGCCTTACTCGAGTAAGGCTTCTTCTTTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-385s21c1
Sequence:CCGGGCCTGGAATAAATTGCTGAATCTCGAGATTCAGCAATTTATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-2667s21c1
Sequence:CCGGGCCTTATGTTTATGACCTAATCTCGAGATTAGGTCATAAACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-931s21c1
Sequence:CCGGGGCTTCTCTGCTTCGTATAATCTCGAGATTATACGAAGCAGAGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011678.1-3480s1c1
Sequence:CCGGCCCGGTTATGAAATGAAGTTACTCGAGTAACTTCATTTCATAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011678.1-1280s1c1
Sequence:CCGGCCGCGTAAAGAAGAAGCCTTACTCGAGTAAGGCTTCTTCTTTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011678.1-348s1c1
Sequence:CCGGGCCTGGAATAAATTGCTGAATCTCGAGATTCAGCAATTTATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011678.1-1910s1c1
Sequence:CCGGCCAGGCTGTTTGTGATCGTATCTCGAGATACGATCACAAACAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011678.1-2630s1c1
Sequence:CCGGGCCTTATGTTTATGACCTAATCTCGAGATTAGGTCATAAACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011678
VALIDATED
USP4 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 4 (proto-oncogene)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-3145s21c1
Sequence:CCGGATGTTAAGAGGCTGGATTATTCTCGAGAATAATCCAGCCTCTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-1317s21c1
Sequence:CCGGCCGCGTAAAGAAGAAGCCTTACTCGAGTAAGGCTTCTTCTTTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-385s21c1
Sequence:CCGGGCCTGGAATAAATTGCTGAATCTCGAGATTCAGCAATTTATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-2667s21c1
Sequence:CCGGGCCTTATGTTTATGACCTAATCTCGAGATTAGGTCATAAACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011678.2-931s21c1
Sequence:CCGGGGCTTCTCTGCTTCGTATAATCTCGAGATTATACGAAGCAGAGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011678.1-3480s1c1
Sequence:CCGGCCCGGTTATGAAATGAAGTTACTCGAGTAACTTCATTTCATAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011678.1-1280s1c1
Sequence:CCGGCCGCGTAAAGAAGAAGCCTTACTCGAGTAAGGCTTCTTCTTTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011678.1-348s1c1
Sequence:CCGGGCCTGGAATAAATTGCTGAATCTCGAGATTCAGCAATTTATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011678.1-1910s1c1
Sequence:CCGGCCAGGCTGTTTGTGATCGTATCTCGAGATACGATCACAAACAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011678.1-2630s1c1
Sequence:CCGGGCCTTATGTTTATGACCTAATCTCGAGATTAGGTCATAAACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks