EMAIL THIS PAGE TO A FRIEND

USP50

ubiquitin specific peptidase 50

UniProtKB ID: Q70EL3
Gene ID:
Mouse(75083) ubiquitin specific peptidase 50
Rat(311399) ubiquitin specific peptidase 50
dog(608487) ubiquitin specific peptidase 50
cow(506271) ubiquitin specific peptidase 50
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203494 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU071001 MISSION® esiRNA esiRNA targeting mouse Usp50 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203494 Rosetta Predictions human pricing
XM_001081082 Rosetta Predictions rat pricing
XM_230564 Rosetta Predictions rat pricing
NM_029163 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373416 predicted 1150
2 SASI_Hs02_00373417 predicted 1090
3 SASI_Hs01_00104958 predicted 738
4 SASI_Hs02_00373418 predicted 199
5 SASI_Hs01_00104959 predicted 754
6 SASI_Hs01_00104960 predicted 405
7 SASI_Hs01_00104962 predicted 744
8 SASI_Hs02_00373419 predicted 247
9 SASI_Hs01_00104963 predicted 781
10 SASI_Hs02_00373420 predicted 991
11 SASI_Hs01_00104961 predicted 477
12 SASI_Hs01_00104964 predicted 535
13 SASI_Hs01_00104965 predicted 209
14 SASI_Hs01_00104966 predicted 420
15 SASI_Hs01_00104967 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370544 predicted 399
2 SASI_Rn02_00370545 predicted 877
3 SASI_Rn02_00370546 predicted 862
4 SASI_Rn02_00370547 predicted 469
5 SASI_Rn02_00370548 predicted 653
6 SASI_Rn02_00370549 predicted 419
7 SASI_Rn02_00370550 predicted 665
8 SASI_Rn02_00370551 predicted 745
9 SASI_Rn02_00370552 predicted 695
10 SASI_Rn02_00370553 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386349 predicted 393
2 SASI_Rn02_00386350 predicted 419
3 SASI_Rn02_00386351 predicted 391
4 SASI_Rn02_00386352 predicted 396
5 SASI_Rn02_00386353 predicted 288
6 SASI_Rn02_00386354 predicted 388
7 SASI_Rn02_00386355 predicted 382
8 SASI_Rn02_00386356 predicted 331
9 SASI_Rn02_00386357 predicted 415
10 SASI_Rn02_00386358 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060677 predicted 702
2 SASI_Mm01_00060678 predicted 1031
3 SASI_Mm01_00060679 predicted 333
4 SASI_Mm01_00060680 predicted 436
5 SASI_Mm01_00060681 predicted 838
6 SASI_Mm01_00060682 predicted 1064
7 SASI_Mm01_00060683 predicted 1018
8 SASI_Mm01_00060684 predicted 468
9 SASI_Mm01_00060685 predicted 727
10 SASI_Mm01_00060686 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029163
USP50 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 50
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-745s1c1
Sequence:CCGGGCACGCACAAGAACGAAGTTTCTCGAGAAACTTCGTTCTTGTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-784s1c1
Sequence:CCGGCCATCCCATCTGACTATGAATCTCGAGATTCATAGTCAGATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-486s1c1
Sequence:CCGGCCAGAGATATTTCTGTCGGCTCTCGAGAGCCGACAGAAATATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-853s1c1
Sequence:CCGGCCTGGAGCAACCAAATCTATTCTCGAGAATAGATTTGGTTGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-560s1c1
Sequence:CCGGGTTCCTGATTTACGTCCTCAACTCGAGTTGAGGACGTAAATCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-988s21c1
Sequence:CCGGGCTGCGGACAGACATCCATTACTCGAGTAATGGATGTCTGTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-606s21c1
Sequence:CCGGACTGCCGAAGAAGAGTAAATGCTCGAGCATTTACTCTTCTTCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-901s21c1
Sequence:CCGGAGCTGTGAGGACCACGATTTCCTCGAGGAAATCGTGGTCCTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-499s21c1
Sequence:CCGGGTCGGCTGTTGGCAGTCTTTACTCGAGTAAAGACTGCCAACAGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-710s21c1
Sequence:CCGGAGTTACAGCATCACATGTTTACTCGAGTAAACATGTGATGCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-1021s21c1
Sequence:CCGGCCTGGACCTCACTCCTTATATCTCGAGATATAAGGAGTGAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-961s21c1
Sequence:CCGGTGACATCCAGGGCACAGTAAACTCGAGTTTACTGTGCCCTGGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029163.3-1460s21c1
Sequence:CCCGTAAGAACTGCAGGCTTCAAAGCTCGAGCTTTGAAGCCTGCAGTTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029163.3-1502s21c1
Sequence:CCGGTGGGTTTCTGTTACAATGTATCTCGAGATACATTGTAACAGAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029163.3-1361s21c1
Sequence:CCGGTAAATCCTTACCACCTACTTACTCGAGTAAGTAGGTGGTAAGGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029163
USP50 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 50
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-745s1c1
Sequence:CCGGGCACGCACAAGAACGAAGTTTCTCGAGAAACTTCGTTCTTGTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-784s1c1
Sequence:CCGGCCATCCCATCTGACTATGAATCTCGAGATTCATAGTCAGATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-486s1c1
Sequence:CCGGCCAGAGATATTTCTGTCGGCTCTCGAGAGCCGACAGAAATATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-853s1c1
Sequence:CCGGCCTGGAGCAACCAAATCTATTCTCGAGAATAGATTTGGTTGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-560s1c1
Sequence:CCGGGTTCCTGATTTACGTCCTCAACTCGAGTTGAGGACGTAAATCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-988s21c1
Sequence:CCGGGCTGCGGACAGACATCCATTACTCGAGTAATGGATGTCTGTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-606s21c1
Sequence:CCGGACTGCCGAAGAAGAGTAAATGCTCGAGCATTTACTCTTCTTCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-901s21c1
Sequence:CCGGAGCTGTGAGGACCACGATTTCCTCGAGGAAATCGTGGTCCTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-499s21c1
Sequence:CCGGGTCGGCTGTTGGCAGTCTTTACTCGAGTAAAGACTGCCAACAGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-710s21c1
Sequence:CCGGAGTTACAGCATCACATGTTTACTCGAGTAAACATGTGATGCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-1021s21c1
Sequence:CCGGCCTGGACCTCACTCCTTATATCTCGAGATATAAGGAGTGAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-961s21c1
Sequence:CCGGTGACATCCAGGGCACAGTAAACTCGAGTTTACTGTGCCCTGGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029163.3-1460s21c1
Sequence:CCCGTAAGAACTGCAGGCTTCAAAGCTCGAGCTTTGAAGCCTGCAGTTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029163.3-1502s21c1
Sequence:CCGGTGGGTTTCTGTTACAATGTATCTCGAGATACATTGTAACAGAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029163.3-1361s21c1
Sequence:CCGGTAAATCCTTACCACCTACTTACTCGAGTAAGTAGGTGGTAAGGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029163
USP50 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 50
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-745s1c1
Sequence:CCGGGCACGCACAAGAACGAAGTTTCTCGAGAAACTTCGTTCTTGTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-784s1c1
Sequence:CCGGCCATCCCATCTGACTATGAATCTCGAGATTCATAGTCAGATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-486s1c1
Sequence:CCGGCCAGAGATATTTCTGTCGGCTCTCGAGAGCCGACAGAAATATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-853s1c1
Sequence:CCGGCCTGGAGCAACCAAATCTATTCTCGAGAATAGATTTGGTTGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029163.1-560s1c1
Sequence:CCGGGTTCCTGATTTACGTCCTCAACTCGAGTTGAGGACGTAAATCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-988s21c1
Sequence:CCGGGCTGCGGACAGACATCCATTACTCGAGTAATGGATGTCTGTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-606s21c1
Sequence:CCGGACTGCCGAAGAAGAGTAAATGCTCGAGCATTTACTCTTCTTCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-901s21c1
Sequence:CCGGAGCTGTGAGGACCACGATTTCCTCGAGGAAATCGTGGTCCTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-499s21c1
Sequence:CCGGGTCGGCTGTTGGCAGTCTTTACTCGAGTAAAGACTGCCAACAGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-710s21c1
Sequence:CCGGAGTTACAGCATCACATGTTTACTCGAGTAAACATGTGATGCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-1021s21c1
Sequence:CCGGCCTGGACCTCACTCCTTATATCTCGAGATATAAGGAGTGAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029163.2-961s21c1
Sequence:CCGGTGACATCCAGGGCACAGTAAACTCGAGTTTACTGTGCCCTGGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029163.3-1460s21c1
Sequence:CCCGTAAGAACTGCAGGCTTCAAAGCTCGAGCTTTGAAGCCTGCAGTTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029163.3-1502s21c1
Sequence:CCGGTGGGTTTCTGTTACAATGTATCTCGAGATACATTGTAACAGAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029163.3-1361s21c1
Sequence:CCGGTAAATCCTTACCACCTACTTACTCGAGTAAGTAGGTGGTAAGGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203494
USP50 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 50
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-471s1c1
Sequence:CCGGCCGGAGAAGATCATATGAGAACTCGAGTTCTCATATGATCTTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-259s1c1
Sequence:CCGGCCAAGCGATTGCAGTGAAGTTCTCGAGAACTTCACTGCAATCGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-582s1c1
Sequence:CCGGCGTATGTTTAAAGTGTGAGAACTCGAGTTCTCACACTTTAAACATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-773s1c1
Sequence:CCGGCCAGTATTTCCAAAGCACCAACTCGAGTTGGTGCTTTGGAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-365s1c1
Sequence:CCGGGCAACCTCTACCCAGCATTTACTCGAGTAAATGCTGGGTAGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203494.3-889s21c1
Sequence:CCGGCTGACCTGGAACAACGAAATTCTCGAGAATTTCGTTGTTCCAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203494.3-1025s21c1
Sequence:CCGGGGAAGCTGAGAACGGATATTCCTCGAGGAATATCCGTTCTCAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203494
USP50 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 50
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-471s1c1
Sequence:CCGGCCGGAGAAGATCATATGAGAACTCGAGTTCTCATATGATCTTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-259s1c1
Sequence:CCGGCCAAGCGATTGCAGTGAAGTTCTCGAGAACTTCACTGCAATCGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-582s1c1
Sequence:CCGGCGTATGTTTAAAGTGTGAGAACTCGAGTTCTCACACTTTAAACATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-773s1c1
Sequence:CCGGCCAGTATTTCCAAAGCACCAACTCGAGTTGGTGCTTTGGAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-365s1c1
Sequence:CCGGGCAACCTCTACCCAGCATTTACTCGAGTAAATGCTGGGTAGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203494.3-889s21c1
Sequence:CCGGCTGACCTGGAACAACGAAATTCTCGAGAATTTCGTTGTTCCAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203494.3-1025s21c1
Sequence:CCGGGGAAGCTGAGAACGGATATTCCTCGAGGAATATCCGTTCTCAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203494
USP50 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 50
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-471s1c1
Sequence:CCGGCCGGAGAAGATCATATGAGAACTCGAGTTCTCATATGATCTTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-259s1c1
Sequence:CCGGCCAAGCGATTGCAGTGAAGTTCTCGAGAACTTCACTGCAATCGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-582s1c1
Sequence:CCGGCGTATGTTTAAAGTGTGAGAACTCGAGTTCTCACACTTTAAACATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-773s1c1
Sequence:CCGGCCAGTATTTCCAAAGCACCAACTCGAGTTGGTGCTTTGGAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203494.1-365s1c1
Sequence:CCGGGCAACCTCTACCCAGCATTTACTCGAGTAAATGCTGGGTAGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203494.3-889s21c1
Sequence:CCGGCTGACCTGGAACAACGAAATTCTCGAGAATTTCGTTGTTCCAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203494.3-1025s21c1
Sequence:CCGGGGAAGCTGAGAACGGATATTCCTCGAGGAATATCCGTTCTCAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks