EMAIL THIS PAGE TO A FRIEND

USP51

ubiquitin specific peptidase 51

UniProtKB ID: Q70EK9, Q8IWJ8
Gene ID:
Mouse(635253) ubiquitin specific protease 51
Rat(317398) ubiquitin specific peptidase 51
Horse(100050479) ubiquitin specific peptidase 51
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001137547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001137547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001137547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_201286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201286 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_201286 Rosetta Predictions human pricing
NM_001108252 Rosetta Predictions rat pricing
XM_001473738 Rosetta Predictions mouse pricing
XM_988786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372924 predicted 1574
2 SASI_Hs02_00372925 predicted 1792
3 SASI_Hs02_00372926 predicted 880
4 SASI_Hs01_00223524 predicted 762
5 SASI_Hs01_00223526 predicted 1345
6 SASI_Hs01_00223527 predicted 1550
7 SASI_Hs01_00223528 predicted 1720
8 SASI_Hs02_00372927 predicted 927
9 SASI_Hs01_00223529 predicted 784
10 SASI_Hs01_00223531 predicted 1867
11 SASI_Hs01_00223523 predicted 965
12 SASI_Hs01_00223525 predicted 853
13 SASI_Hs01_00223530 predicted 1460
14 SASI_Hs01_00223532 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236824 predicted 1256
2 SASI_Rn02_00236825 predicted 1815
3 SASI_Rn02_00236826 predicted 1168
4 SASI_Rn02_00236827 predicted 1221
5 SASI_Rn02_00236828 predicted 1925
6 SASI_Rn02_00236829 predicted 850
7 SASI_Rn02_00236830 predicted 612
8 SASI_Rn02_00236831 predicted 781
9 SASI_Rn02_00236832 predicted 801
10 SASI_Rn02_00236833 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00370343 predicted 398
2 SASI_Mm02_00370344 predicted 450
3 SASI_Mm02_00370345 predicted 237
4 SASI_Mm02_00370346 predicted 202
5 SASI_Mm02_00370347 predicted 336
6 SASI_Mm02_00370348 predicted 566
7 SASI_Mm02_00370349 predicted 248
8 SASI_Mm02_00370350 predicted 218
9 SASI_Mm02_00370351 predicted 554
10 SASI_Mm02_00370352 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285557 predicted 299
2 SASI_Mm01_00285558 predicted 243
3 SASI_Mm01_00285559 predicted 291
4 SASI_Mm01_00285560 predicted 202
5 SASI_Mm01_00285561 predicted 245
6 SASI_Mm01_00285562 predicted 223
7 SASI_Mm01_00285563 predicted 210
8 SASI_Mm01_00285564 predicted 248
9 SASI_Mm01_00285565 predicted 229
10 SASI_Mm01_00285566 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001137547
USP51 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 51
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-1341s21c1
Sequence:CCGGGTCCTCATATTCCCTATAAATCTCGAGATTTATAGGGAATATGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-1536s21c1
Sequence:CCGGGTAGTCTGCAGTCAGATTTAACTCGAGTTAAATCTGACTGCAGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-653s21c1
Sequence:CCGGTGTCATGTAGAGAGCTTTAAACTCGAGTTTAAAGCTCTCTACATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-1919s21c1
Sequence:CCGGCCGTTCTTGGCTTCTACTAAACTCGAGTTTAGTAGAAGCCAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-1614s21c1
Sequence:CCGGTGGATTTGCCTGGGCCTTATACTCGAGTATAAGGCCCAGGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001137547
USP51 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 51
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-1341s21c1
Sequence:CCGGGTCCTCATATTCCCTATAAATCTCGAGATTTATAGGGAATATGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-1536s21c1
Sequence:CCGGGTAGTCTGCAGTCAGATTTAACTCGAGTTAAATCTGACTGCAGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-653s21c1
Sequence:CCGGTGTCATGTAGAGAGCTTTAAACTCGAGTTTAAAGCTCTCTACATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-1919s21c1
Sequence:CCGGCCGTTCTTGGCTTCTACTAAACTCGAGTTTAGTAGAAGCCAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-1614s21c1
Sequence:CCGGTGGATTTGCCTGGGCCTTATACTCGAGTATAAGGCCCAGGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001137547
USP51 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 51
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-1341s21c1
Sequence:CCGGGTCCTCATATTCCCTATAAATCTCGAGATTTATAGGGAATATGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-1536s21c1
Sequence:CCGGGTAGTCTGCAGTCAGATTTAACTCGAGTTAAATCTGACTGCAGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-653s21c1
Sequence:CCGGTGTCATGTAGAGAGCTTTAAACTCGAGTTTAAAGCTCTCTACATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-1919s21c1
Sequence:CCGGCCGTTCTTGGCTTCTACTAAACTCGAGTTTAGTAGAAGCCAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137547.1-1614s21c1
Sequence:CCGGTGGATTTGCCTGGGCCTTATACTCGAGTATAAGGCCCAGGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201286
USP51 MISSION shRNA Bacterial Glycerol Stock
ubiquitin specific peptidase 51
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-1472s1c1
Sequence:CCGGGCCTGCAATCAGATGTCACATCTCGAGATGTGACATCTGATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-1377s1c1
Sequence:CCGGCGTGCTACATAGACACAGCAACTCGAGTTGCTGTGTCTATGTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-1792s1c1
Sequence:CCGGCGGTTTGAGCATGTAGGCAAACTCGAGTTTGCCTACATGCTCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-669s1c1
Sequence:CCGGCCCAGAGACTAGGAAACGTAACTCGAGTTACGTTTCCTAGTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-1915s1c1
Sequence:CCGGCCAACAGATTGTGTGCCCAATCTCGAGATTGGGCACACAATCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201286
USP51 MISSION shRNA shRNA Plasmid DNA
ubiquitin specific peptidase 51
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-1472s1c1
Sequence:CCGGGCCTGCAATCAGATGTCACATCTCGAGATGTGACATCTGATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-1377s1c1
Sequence:CCGGCGTGCTACATAGACACAGCAACTCGAGTTGCTGTGTCTATGTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-1792s1c1
Sequence:CCGGCGGTTTGAGCATGTAGGCAAACTCGAGTTTGCCTACATGCTCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-669s1c1
Sequence:CCGGCCCAGAGACTAGGAAACGTAACTCGAGTTACGTTTCCTAGTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-1915s1c1
Sequence:CCGGCCAACAGATTGTGTGCCCAATCTCGAGATTGGGCACACAATCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201286
USP51 MISSION shRNA Lentiviral Transduction Particles
ubiquitin specific peptidase 51
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-1472s1c1
Sequence:CCGGGCCTGCAATCAGATGTCACATCTCGAGATGTGACATCTGATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-1377s1c1
Sequence:CCGGCGTGCTACATAGACACAGCAACTCGAGTTGCTGTGTCTATGTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-1792s1c1
Sequence:CCGGCGGTTTGAGCATGTAGGCAAACTCGAGTTTGCCTACATGCTCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-669s1c1
Sequence:CCGGCCCAGAGACTAGGAAACGTAACTCGAGTTACGTTTCCTAGTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201286.1-1915s1c1
Sequence:CCGGCCAACAGATTGTGTGCCCAATCTCGAGATTGGGCACACAATCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks